Incidental Mutation 'R7098:Thoc3'
ID550663
Institutional Source Beutler Lab
Gene Symbol Thoc3
Ensembl Gene ENSMUSG00000025872
Gene NameTHO complex 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7098 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location54458837-54468849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54466306 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 168 (I168T)
Ref Sequence ENSEMBL: ENSMUSP00000026990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026990]
Predicted Effect probably damaging
Transcript: ENSMUST00000026990
AA Change: I168T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026990
Gene: ENSMUSG00000025872
AA Change: I168T

DomainStartEndE-ValueType
WD40 44 83 3.1e-8 SMART
WD40 88 128 1.3e-11 SMART
WD40 131 169 1.7e-3 SMART
Blast:WD40 172 210 1e-16 BLAST
WD40 213 252 3.8e-10 SMART
WD40 255 294 1.1e-3 SMART
WD40 297 346 1.4e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nuclear THO transcription elongation complex, which is part of the larger transcription export (TREX) complex that couples messenger RNA processing and export. In humans, the transcription export complex is recruited to the 5'-end of messenger RNAs in a splicing- and cap-dependent manner. Studies of a related complex in mouse suggest that the metazoan transcription export complex is involved in cell differentiation and development. A pseudogene of this gene has been defined on chromosome 5. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Apba2 T A 7: 64,736,948 V441D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Cc2d2a A T 5: 43,683,139 T161S probably benign Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Lrrc40 T A 3: 158,041,639 N129K probably benign Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Rap1gap C A 4: 137,716,082 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Sh3tc1 A T 5: 35,702,014 probably null Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Sult2a1 A T 7: 13,816,053 probably null Het
Tgfb2 C T 1: 186,630,637 R330H probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Ttll5 A G 12: 85,917,673 probably null Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Thoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Thoc3 APN 13 54467820 splice site probably benign
IGL02811:Thoc3 APN 13 54460175 missense probably benign 0.24
IGL03210:Thoc3 APN 13 54466222 missense probably benign 0.00
R1512:Thoc3 UTSW 13 54466178 critical splice donor site probably null
R2252:Thoc3 UTSW 13 54467833 missense probably benign 0.00
R4133:Thoc3 UTSW 13 54468548 missense probably benign 0.16
R5686:Thoc3 UTSW 13 54467873 missense probably damaging 0.99
R5722:Thoc3 UTSW 13 54460201 missense probably damaging 1.00
R6225:Thoc3 UTSW 13 54467972 missense probably benign 0.04
R7088:Thoc3 UTSW 13 54463752 missense probably damaging 1.00
R7662:Thoc3 UTSW 13 54463804 missense probably damaging 1.00
R7778:Thoc3 UTSW 13 54463778 missense probably damaging 1.00
R7824:Thoc3 UTSW 13 54463778 missense probably damaging 1.00
Z1177:Thoc3 UTSW 13 54460186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGTCTTTTGGGACAGGCTC -3'
(R):5'- AAGTGCTGAAGGTAGCTCTG -3'

Sequencing Primer
(F):5'- TTGGGACAGGCTCACAGTTAACTC -3'
(R):5'- GATCTTCTTTCCAGGAGAGCAG -3'
Posted On2019-05-15