Incidental Mutation 'R7099:Prom2'
ID 550685
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Name prominin 2
Synonyms
MMRRC Submission 045191-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7099 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 127368873-127383337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127381698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 206 (E206G)
Ref Sequence ENSEMBL: ENSMUSP00000028855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
AlphaFold Q3UUY6
Predicted Effect probably benign
Transcript: ENSMUST00000028855
AA Change: E206G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: E206G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103214
AA Change: E206G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: E206G

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik C T 16: 64,591,151 (GRCm39) A26T probably benign Het
Acly T C 11: 100,383,117 (GRCm39) probably null Het
Adam29 A C 8: 56,324,439 (GRCm39) L672V probably benign Het
Adgrf1 T C 17: 43,621,493 (GRCm39) S577P probably benign Het
Ankar T C 1: 72,682,452 (GRCm39) K1371R probably damaging Het
Arid5b T C 10: 67,934,009 (GRCm39) D631G probably damaging Het
Brpf3 T C 17: 29,025,611 (GRCm39) V228A probably benign Het
C3 T C 17: 57,513,276 (GRCm39) D1457G probably benign Het
Calr4 A T 4: 109,099,426 (GRCm39) N143I probably benign Het
Catsperd T G 17: 56,935,811 (GRCm39) probably null Het
Cobl T A 11: 12,246,540 (GRCm39) H154L Het
Cryzl2 G A 1: 157,316,154 (GRCm39) probably benign Het
Dennd1c A G 17: 57,374,915 (GRCm39) probably null Het
Dnah8 A T 17: 30,923,698 (GRCm39) D1222V possibly damaging Het
Errfi1 T C 4: 150,951,225 (GRCm39) S218P probably benign Het
Fbxw27 G T 9: 109,599,223 (GRCm39) T398N probably damaging Het
Fhod3 A G 18: 25,223,219 (GRCm39) D855G probably benign Het
Flii A G 11: 60,611,481 (GRCm39) V410A probably benign Het
Fsip2 C A 2: 82,817,968 (GRCm39) P4567Q probably benign Het
Fxyd1 T G 7: 30,752,458 (GRCm39) Q66H probably damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gramd2b C T 18: 56,625,017 (GRCm39) T370I probably benign Het
Kdr A G 5: 76,104,993 (GRCm39) V1079A probably damaging Het
Lmx1a G A 1: 167,658,115 (GRCm39) G166D probably damaging Het
Lrrfip2 A G 9: 111,002,176 (GRCm39) R92G probably benign Het
Map1a T A 2: 121,130,998 (GRCm39) S605T probably benign Het
Megf8 A T 7: 25,045,945 (GRCm39) D1496V probably damaging Het
Mgam T C 6: 40,638,650 (GRCm39) V461A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Nav3 T C 10: 109,539,195 (GRCm39) T2069A probably benign Het
Nbeal2 A T 9: 110,474,506 (GRCm39) probably null Het
Ndst1 A G 18: 60,828,572 (GRCm39) F661L possibly damaging Het
Neu3 G A 7: 99,463,027 (GRCm39) T232M possibly damaging Het
Nf1 T C 11: 79,461,156 (GRCm39) S741P probably benign Het
Nr5a1 G T 2: 38,584,148 (GRCm39) L424M probably damaging Het
Nuf2 G A 1: 169,333,641 (GRCm39) T345M probably benign Het
Or4d10c A G 19: 12,065,530 (GRCm39) F209L possibly damaging Het
Or4k51 A T 2: 111,585,421 (GRCm39) T276S probably benign Het
Or6d12 T A 6: 116,493,721 (GRCm39) *328R probably null Het
Or8g33 G A 9: 39,337,599 (GRCm39) T256I probably benign Het
Otud7a A G 7: 63,407,203 (GRCm39) E502G possibly damaging Het
Otulin A G 15: 27,608,832 (GRCm39) L237S probably damaging Het
Pias1 A G 9: 62,788,427 (GRCm39) M79T Het
Scarb1 A T 5: 125,381,414 (GRCm39) N43K probably damaging Het
Sdad1 A G 5: 92,441,832 (GRCm39) V365A possibly damaging Het
Sdk2 T C 11: 113,725,731 (GRCm39) T1173A probably damaging Het
Sidt1 A G 16: 44,063,860 (GRCm39) S803P probably damaging Het
Slc45a1 A T 4: 150,714,030 (GRCm39) D738E probably benign Het
Slc4a7 T A 14: 14,733,750 (GRCm38) H53Q probably damaging Het
Spata22 T C 11: 73,231,225 (GRCm39) F160L probably benign Het
Stag1 G A 9: 100,826,879 (GRCm39) V949I probably benign Het
Syne1 T C 10: 5,073,744 (GRCm39) S1200G probably benign Het
Tbc1d9 A G 8: 83,981,520 (GRCm39) E729G probably damaging Het
Tcaf2 C T 6: 42,607,275 (GRCm39) M226I probably benign Het
Tep1 T C 14: 51,081,944 (GRCm39) probably null Het
Tigd2 C A 6: 59,187,166 (GRCm39) T11K probably damaging Het
Trappc9 A G 15: 72,565,468 (GRCm39) V941A probably benign Het
Ugt2b37 A G 5: 87,388,848 (GRCm39) M455T probably benign Het
Usp42 A T 5: 143,712,400 (GRCm39) S95T probably damaging Het
Usp44 T C 10: 93,686,049 (GRCm39) I488T possibly damaging Het
Vmn1r73 T C 7: 11,490,320 (GRCm39) I46T probably damaging Het
Vmn2r34 A T 7: 7,675,540 (GRCm39) I616N probably damaging Het
Zfp352 A G 4: 90,113,117 (GRCm39) K419R probably benign Het
Zfp595 T A 13: 67,465,711 (GRCm39) H187L probably damaging Het
Zfp804b A T 5: 6,822,161 (GRCm39) S301T probably benign Het
Zzef1 T C 11: 72,763,475 (GRCm39) V1374A possibly damaging Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127,383,059 (GRCm39) missense probably benign 0.04
IGL01140:Prom2 APN 2 127,373,125 (GRCm39) splice site probably benign
IGL01300:Prom2 APN 2 127,377,009 (GRCm39) missense probably benign 0.44
IGL01445:Prom2 APN 2 127,381,433 (GRCm39) splice site probably benign
IGL01472:Prom2 APN 2 127,374,802 (GRCm39) missense probably benign 0.39
IGL01541:Prom2 APN 2 127,371,050 (GRCm39) critical splice donor site probably null
IGL01991:Prom2 APN 2 127,371,142 (GRCm39) missense probably damaging 1.00
IGL02421:Prom2 APN 2 127,373,802 (GRCm39) critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127,371,391 (GRCm39) missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127,380,577 (GRCm39) splice site probably benign
IGL02826:Prom2 APN 2 127,373,036 (GRCm39) missense probably benign 0.07
IGL02830:Prom2 APN 2 127,376,989 (GRCm39) missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127,370,734 (GRCm39) missense probably benign 0.10
R0110:Prom2 UTSW 2 127,373,033 (GRCm39) missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127,380,258 (GRCm39) splice site probably benign
R0165:Prom2 UTSW 2 127,381,434 (GRCm39) splice site probably benign
R0220:Prom2 UTSW 2 127,383,027 (GRCm39) missense probably benign 0.03
R0466:Prom2 UTSW 2 127,370,709 (GRCm39) missense probably damaging 0.99
R0505:Prom2 UTSW 2 127,374,787 (GRCm39) missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127,381,915 (GRCm39) critical splice donor site probably null
R0633:Prom2 UTSW 2 127,381,445 (GRCm39) missense probably benign 0.19
R0947:Prom2 UTSW 2 127,380,183 (GRCm39) missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127,382,082 (GRCm39) missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127,374,802 (GRCm39) missense probably damaging 1.00
R1859:Prom2 UTSW 2 127,383,017 (GRCm39) missense probably damaging 0.97
R1864:Prom2 UTSW 2 127,381,707 (GRCm39) missense probably benign 0.00
R1866:Prom2 UTSW 2 127,378,514 (GRCm39) missense probably damaging 0.99
R3824:Prom2 UTSW 2 127,377,593 (GRCm39) splice site probably benign
R4472:Prom2 UTSW 2 127,382,111 (GRCm39) missense probably benign 0.06
R5078:Prom2 UTSW 2 127,373,757 (GRCm39) missense probably benign 0.00
R5889:Prom2 UTSW 2 127,371,331 (GRCm39) missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127,372,053 (GRCm39) nonsense probably null
R6214:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6215:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6914:Prom2 UTSW 2 127,372,295 (GRCm39) missense possibly damaging 0.78
R7427:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7428:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7525:Prom2 UTSW 2 127,374,701 (GRCm39) missense probably benign
R8477:Prom2 UTSW 2 127,381,124 (GRCm39) missense probably benign 0.01
R9287:Prom2 UTSW 2 127,380,185 (GRCm39) missense probably damaging 0.98
R9337:Prom2 UTSW 2 127,371,094 (GRCm39) missense probably damaging 0.99
Z1176:Prom2 UTSW 2 127,374,695 (GRCm39) missense probably damaging 1.00
Z1177:Prom2 UTSW 2 127,381,446 (GRCm39) missense probably benign 0.19
Z1177:Prom2 UTSW 2 127,380,225 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTGCTCAGCAATGGCC -3'
(R):5'- TTCTGTGAGAGGCTCCCTAG -3'

Sequencing Primer
(F):5'- AATGGCCCGCAGCTCCTAAG -3'
(R):5'- TGTGAGAGGCTCCCTAGGTCAG -3'
Posted On 2019-05-15