Incidental Mutation 'R7099:Sdad1'
ID550693
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene NameSDA1 domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R7099 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92284010-92310479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92293973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 365 (V365A)
Ref Sequence ENSEMBL: ENSMUSP00000031364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031364
AA Change: V365A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: V365A

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201143
AA Change: V364A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: V364A

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik C T 16: 64,770,788 A26T probably benign Het
Acly T C 11: 100,492,291 probably null Het
Adam29 A C 8: 55,871,404 L672V probably benign Het
Adgrf1 T C 17: 43,310,602 S577P probably benign Het
Ankar T C 1: 72,643,293 K1371R probably damaging Het
Arid5b T C 10: 68,098,179 D631G probably damaging Het
Brpf3 T C 17: 28,806,637 V228A probably benign Het
C3 T C 17: 57,206,276 D1457G probably benign Het
Calr4 A T 4: 109,242,229 N143I probably benign Het
Catsperd T G 17: 56,628,811 probably null Het
Cobl T A 11: 12,296,540 H154L Het
Cryzl2 G A 1: 157,488,584 probably benign Het
Dennd1c A G 17: 57,067,915 probably null Het
Dnah8 A T 17: 30,704,724 D1222V possibly damaging Het
Errfi1 T C 4: 150,866,768 S218P probably benign Het
Fbxw27 G T 9: 109,770,155 T398N probably damaging Het
Fhod3 A G 18: 25,090,162 D855G probably benign Het
Flii A G 11: 60,720,655 V410A probably benign Het
Fsip2 C A 2: 82,987,624 P4567Q probably benign Het
Fxyd1 T G 7: 31,053,033 Q66H probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gramd3 C T 18: 56,491,945 T370I probably benign Het
Kdr A G 5: 75,944,333 V1079A probably damaging Het
Lmx1a G A 1: 167,830,546 G166D probably damaging Het
Lrrfip2 A G 9: 111,173,108 R92G probably benign Het
Map1a T A 2: 121,300,517 S605T probably benign Het
Megf8 A T 7: 25,346,520 D1496V probably damaging Het
Mgam T C 6: 40,661,716 V461A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nav3 T C 10: 109,703,334 T2069A probably benign Het
Nbeal2 A T 9: 110,645,438 probably null Het
Ndst1 A G 18: 60,695,500 F661L possibly damaging Het
Neu3 G A 7: 99,813,820 T232M possibly damaging Het
Nf1 T C 11: 79,570,330 S741P probably benign Het
Nr5a1 G T 2: 38,694,136 L424M probably damaging Het
Nuf2 G A 1: 169,506,072 T345M probably benign Het
Olfr1301 A T 2: 111,755,076 T276S probably benign Het
Olfr1426 A G 19: 12,088,166 F209L possibly damaging Het
Olfr212 T A 6: 116,516,760 *328R probably null Het
Olfr952 G A 9: 39,426,303 T256I probably benign Het
Otud7a A G 7: 63,757,455 E502G possibly damaging Het
Otulin A G 15: 27,608,746 L237S probably damaging Het
Pias1 A G 9: 62,881,145 M79T Het
Prom2 T C 2: 127,539,778 E206G probably benign Het
Scarb1 A T 5: 125,304,350 N43K probably damaging Het
Sdk2 T C 11: 113,834,905 T1173A probably damaging Het
Sidt1 A G 16: 44,243,497 S803P probably damaging Het
Slc45a1 A T 4: 150,629,573 D738E probably benign Het
Slc4a7 T A 14: 14,733,750 H53Q probably damaging Het
Spata22 T C 11: 73,340,399 F160L probably benign Het
Stag1 G A 9: 100,944,826 V949I probably benign Het
Syne1 T C 10: 5,123,744 S1200G probably benign Het
Tbc1d9 A G 8: 83,254,891 E729G probably damaging Het
Tcaf2 C T 6: 42,630,341 M226I probably benign Het
Tep1 T C 14: 50,844,487 probably null Het
Tigd2 C A 6: 59,210,181 T11K probably damaging Het
Trappc9 A G 15: 72,693,619 V941A probably benign Het
Ugt2b37 A G 5: 87,240,989 M455T probably benign Het
Usp42 A T 5: 143,726,645 S95T probably damaging Het
Usp44 T C 10: 93,850,187 I488T possibly damaging Het
Vmn1r73 T C 7: 11,756,393 I46T probably damaging Het
Vmn2r34 A T 7: 7,672,541 I616N probably damaging Het
Zfp352 A G 4: 90,224,880 K419R probably benign Het
Zfp595 T A 13: 67,317,647 H187L probably damaging Het
Zfp804b A T 5: 6,772,161 S301T probably benign Het
Zzef1 T C 11: 72,872,649 V1374A possibly damaging Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92303773 splice site probably null
IGL01355:Sdad1 APN 5 92302679 missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92297160 missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92291762 missense probably benign 0.03
IGL02503:Sdad1 APN 5 92301802 unclassified probably benign
IGL02739:Sdad1 APN 5 92290072 missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92291918 missense probably damaging 1.00
R0583:Sdad1 UTSW 5 92305064 missense probably damaging 0.97
R1169:Sdad1 UTSW 5 92298233 missense probably benign 0.32
R1496:Sdad1 UTSW 5 92309823 missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92305296 nonsense probably null
R1848:Sdad1 UTSW 5 92292651 critical splice donor site probably null
R2419:Sdad1 UTSW 5 92305818 missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92300099 missense probably benign 0.00
R2509:Sdad1 UTSW 5 92305825 missense probably benign 0.12
R4043:Sdad1 UTSW 5 92302694 missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92298257 missense probably benign 0.01
R4477:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92303934 missense probably benign 0.00
R5288:Sdad1 UTSW 5 92286825 makesense probably null
R6331:Sdad1 UTSW 5 92303930 missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92298190 critical splice donor site probably null
R7420:Sdad1 UTSW 5 92305737 missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92300121 missense probably benign 0.10
R7714:Sdad1 UTSW 5 92302679 missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92300089 missense probably benign 0.01
R8198:Sdad1 UTSW 5 92291952 missense probably damaging 0.96
R8347:Sdad1 UTSW 5 92298229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTTATTAAACTCAGAAGCCTCAG -3'
(R):5'- CGGTTGAACCATGCAGACAG -3'

Sequencing Primer
(F):5'- AGCTCCTTTCTGTCAACTGTACAG -3'
(R):5'- ACCATGCAGACAGGTCGG -3'
Posted On2019-05-15