Incidental Mutation 'R7099:Usp44'
ID 550716
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms E430004F17Rik
MMRRC Submission 045191-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7099 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 93667417-93693950 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 93686049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 488 (I488T)
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000095333
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216224
AA Change: I488T

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.1598 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik C T 16: 64,591,151 (GRCm39) A26T probably benign Het
Acly T C 11: 100,383,117 (GRCm39) probably null Het
Adam29 A C 8: 56,324,439 (GRCm39) L672V probably benign Het
Adgrf1 T C 17: 43,621,493 (GRCm39) S577P probably benign Het
Ankar T C 1: 72,682,452 (GRCm39) K1371R probably damaging Het
Arid5b T C 10: 67,934,009 (GRCm39) D631G probably damaging Het
Brpf3 T C 17: 29,025,611 (GRCm39) V228A probably benign Het
C3 T C 17: 57,513,276 (GRCm39) D1457G probably benign Het
Calr4 A T 4: 109,099,426 (GRCm39) N143I probably benign Het
Catsperd T G 17: 56,935,811 (GRCm39) probably null Het
Cobl T A 11: 12,246,540 (GRCm39) H154L Het
Cryzl2 G A 1: 157,316,154 (GRCm39) probably benign Het
Dennd1c A G 17: 57,374,915 (GRCm39) probably null Het
Dnah8 A T 17: 30,923,698 (GRCm39) D1222V possibly damaging Het
Errfi1 T C 4: 150,951,225 (GRCm39) S218P probably benign Het
Fbxw27 G T 9: 109,599,223 (GRCm39) T398N probably damaging Het
Fhod3 A G 18: 25,223,219 (GRCm39) D855G probably benign Het
Flii A G 11: 60,611,481 (GRCm39) V410A probably benign Het
Fsip2 C A 2: 82,817,968 (GRCm39) P4567Q probably benign Het
Fxyd1 T G 7: 30,752,458 (GRCm39) Q66H probably damaging Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gramd2b C T 18: 56,625,017 (GRCm39) T370I probably benign Het
Kdr A G 5: 76,104,993 (GRCm39) V1079A probably damaging Het
Lmx1a G A 1: 167,658,115 (GRCm39) G166D probably damaging Het
Lrrfip2 A G 9: 111,002,176 (GRCm39) R92G probably benign Het
Map1a T A 2: 121,130,998 (GRCm39) S605T probably benign Het
Megf8 A T 7: 25,045,945 (GRCm39) D1496V probably damaging Het
Mgam T C 6: 40,638,650 (GRCm39) V461A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Nav3 T C 10: 109,539,195 (GRCm39) T2069A probably benign Het
Nbeal2 A T 9: 110,474,506 (GRCm39) probably null Het
Ndst1 A G 18: 60,828,572 (GRCm39) F661L possibly damaging Het
Neu3 G A 7: 99,463,027 (GRCm39) T232M possibly damaging Het
Nf1 T C 11: 79,461,156 (GRCm39) S741P probably benign Het
Nr5a1 G T 2: 38,584,148 (GRCm39) L424M probably damaging Het
Nuf2 G A 1: 169,333,641 (GRCm39) T345M probably benign Het
Or4d10c A G 19: 12,065,530 (GRCm39) F209L possibly damaging Het
Or4k51 A T 2: 111,585,421 (GRCm39) T276S probably benign Het
Or6d12 T A 6: 116,493,721 (GRCm39) *328R probably null Het
Or8g33 G A 9: 39,337,599 (GRCm39) T256I probably benign Het
Otud7a A G 7: 63,407,203 (GRCm39) E502G possibly damaging Het
Otulin A G 15: 27,608,832 (GRCm39) L237S probably damaging Het
Pias1 A G 9: 62,788,427 (GRCm39) M79T Het
Prom2 T C 2: 127,381,698 (GRCm39) E206G probably benign Het
Scarb1 A T 5: 125,381,414 (GRCm39) N43K probably damaging Het
Sdad1 A G 5: 92,441,832 (GRCm39) V365A possibly damaging Het
Sdk2 T C 11: 113,725,731 (GRCm39) T1173A probably damaging Het
Sidt1 A G 16: 44,063,860 (GRCm39) S803P probably damaging Het
Slc45a1 A T 4: 150,714,030 (GRCm39) D738E probably benign Het
Slc4a7 T A 14: 14,733,750 (GRCm38) H53Q probably damaging Het
Spata22 T C 11: 73,231,225 (GRCm39) F160L probably benign Het
Stag1 G A 9: 100,826,879 (GRCm39) V949I probably benign Het
Syne1 T C 10: 5,073,744 (GRCm39) S1200G probably benign Het
Tbc1d9 A G 8: 83,981,520 (GRCm39) E729G probably damaging Het
Tcaf2 C T 6: 42,607,275 (GRCm39) M226I probably benign Het
Tep1 T C 14: 51,081,944 (GRCm39) probably null Het
Tigd2 C A 6: 59,187,166 (GRCm39) T11K probably damaging Het
Trappc9 A G 15: 72,565,468 (GRCm39) V941A probably benign Het
Ugt2b37 A G 5: 87,388,848 (GRCm39) M455T probably benign Het
Usp42 A T 5: 143,712,400 (GRCm39) S95T probably damaging Het
Vmn1r73 T C 7: 11,490,320 (GRCm39) I46T probably damaging Het
Vmn2r34 A T 7: 7,675,540 (GRCm39) I616N probably damaging Het
Zfp352 A G 4: 90,113,117 (GRCm39) K419R probably benign Het
Zfp595 T A 13: 67,465,711 (GRCm39) H187L probably damaging Het
Zfp804b A T 5: 6,822,161 (GRCm39) S301T probably benign Het
Zzef1 T C 11: 72,763,475 (GRCm39) V1374A possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93,681,517 (GRCm39) start gained probably benign
R0497:Usp44 UTSW 10 93,682,668 (GRCm39) missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93,683,082 (GRCm39) intron probably benign
R1521:Usp44 UTSW 10 93,683,048 (GRCm39) nonsense probably null
R4032:Usp44 UTSW 10 93,683,127 (GRCm39) intron probably benign
R4212:Usp44 UTSW 10 93,682,632 (GRCm39) missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93,682,768 (GRCm39) missense probably damaging 1.00
R4764:Usp44 UTSW 10 93,681,933 (GRCm39) missense probably benign 0.17
R5095:Usp44 UTSW 10 93,682,707 (GRCm39) missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93,681,840 (GRCm39) missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93,682,494 (GRCm39) missense probably damaging 0.96
R6193:Usp44 UTSW 10 93,683,010 (GRCm39) intron probably benign
R6233:Usp44 UTSW 10 93,686,202 (GRCm39) missense probably damaging 1.00
R6338:Usp44 UTSW 10 93,682,375 (GRCm39) missense probably damaging 1.00
R6374:Usp44 UTSW 10 93,692,172 (GRCm39) missense probably benign 0.12
R6556:Usp44 UTSW 10 93,681,870 (GRCm39) missense probably benign 0.20
R6615:Usp44 UTSW 10 93,682,351 (GRCm39) missense possibly damaging 0.48
R7224:Usp44 UTSW 10 93,681,855 (GRCm39) missense probably benign 0.08
R7361:Usp44 UTSW 10 93,682,330 (GRCm39) missense probably benign 0.00
R7576:Usp44 UTSW 10 93,682,290 (GRCm39) missense probably damaging 0.99
R8014:Usp44 UTSW 10 93,688,571 (GRCm39) critical splice acceptor site probably null
R8695:Usp44 UTSW 10 93,682,365 (GRCm39) missense probably damaging 1.00
R8919:Usp44 UTSW 10 93,693,775 (GRCm39) missense probably benign 0.00
R8950:Usp44 UTSW 10 93,682,129 (GRCm39) missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93,681,645 (GRCm39) missense probably benign 0.09
R9254:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93,682,851 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAACCCACTTGTCAGCGTG -3'
(R):5'- CTGAAGCACTTTCTCCCAGGTC -3'

Sequencing Primer
(F):5'- CACTTGTCAGCGTGCTAATAG -3'
(R):5'- TTAATCTTACAAAAGCACAGAGAGC -3'
Posted On 2019-05-15