Mutagenetix > Incidental Mutation

Incidental Mutation 'R7099:Ndst1'

550737

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

045191-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7099 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60695500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 661 (F661L)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169273
AA Change: F661L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: F661L

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.1822

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930453N24Rik	C	T	16: 64,770,788	A26T	probably benign	Het
Acly	T	C	11: 100,492,291		probably null	Het
Adam29	A	C	8: 55,871,404	L672V	probably benign	Het
Adgrf1	T	C	17: 43,310,602	S577P	probably benign	Het
Ankar	T	C	1: 72,643,293	K1371R	probably damaging	Het
Arid5b	T	C	10: 68,098,179	D631G	probably damaging	Het
Brpf3	T	C	17: 28,806,637	V228A	probably benign	Het
C3	T	C	17: 57,206,276	D1457G	probably benign	Het
Calr4	A	T	4: 109,242,229	N143I	probably benign	Het
Catsperd	T	G	17: 56,628,811		probably null	Het
Cobl	T	A	11: 12,296,540	H154L		Het
Cryzl2	G	A	1: 157,488,584		probably benign	Het
Dennd1c	A	G	17: 57,067,915		probably null	Het
Dnah8	A	T	17: 30,704,724	D1222V	possibly damaging	Het
Errfi1	T	C	4: 150,866,768	S218P	probably benign	Het
Fbxw27	G	T	9: 109,770,155	T398N	probably damaging	Het
Fhod3	A	G	18: 25,090,162	D855G	probably benign	Het
Flii	A	G	11: 60,720,655	V410A	probably benign	Het
Fsip2	C	A	2: 82,987,624	P4567Q	probably benign	Het
Fxyd1	T	G	7: 31,053,033	Q66H	probably damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gramd3	C	T	18: 56,491,945	T370I	probably benign	Het
Kdr	A	G	5: 75,944,333	V1079A	probably damaging	Het
Lmx1a	G	A	1: 167,830,546	G166D	probably damaging	Het
Lrrfip2	A	G	9: 111,173,108	R92G	probably benign	Het
Map1a	T	A	2: 121,300,517	S605T	probably benign	Het
Megf8	A	T	7: 25,346,520	D1496V	probably damaging	Het
Mgam	T	C	6: 40,661,716	V461A	probably benign	Het
Muc6	AGGCGCAGAAACCCTGGC	AGGC	7: 141,634,450		probably null	Het
Nav3	T	C	10: 109,703,334	T2069A	probably benign	Het
Nbeal2	A	T	9: 110,645,438		probably null	Het
Neu3	G	A	7: 99,813,820	T232M	possibly damaging	Het
Nf1	T	C	11: 79,570,330	S741P	probably benign	Het
Nr5a1	G	T	2: 38,694,136	L424M	probably damaging	Het
Nuf2	G	A	1: 169,506,072	T345M	probably benign	Het
Olfr1301	A	T	2: 111,755,076	T276S	probably benign	Het
Olfr1426	A	G	19: 12,088,166	F209L	possibly damaging	Het
Olfr212	T	A	6: 116,516,760	*328R	probably null	Het
Olfr952	G	A	9: 39,426,303	T256I	probably benign	Het
Otud7a	A	G	7: 63,757,455	E502G	possibly damaging	Het
Otulin	A	G	15: 27,608,746	L237S	probably damaging	Het
Pias1	A	G	9: 62,881,145	M79T		Het
Prom2	T	C	2: 127,539,778	E206G	probably benign	Het
Scarb1	A	T	5: 125,304,350	N43K	probably damaging	Het
Sdad1	A	G	5: 92,293,973	V365A	possibly damaging	Het
Sdk2	T	C	11: 113,834,905	T1173A	probably damaging	Het
Sidt1	A	G	16: 44,243,497	S803P	probably damaging	Het
Slc45a1	A	T	4: 150,629,573	D738E	probably benign	Het
Slc4a7	T	A	14: 14,733,750	H53Q	probably damaging	Het
Spata22	T	C	11: 73,340,399	F160L	probably benign	Het
Stag1	G	A	9: 100,944,826	V949I	probably benign	Het
Syne1	T	C	10: 5,123,744	S1200G	probably benign	Het
Tbc1d9	A	G	8: 83,254,891	E729G	probably damaging	Het
Tcaf2	C	T	6: 42,630,341	M226I	probably benign	Het
Tep1	T	C	14: 50,844,487		probably null	Het
Tigd2	C	A	6: 59,210,181	T11K	probably damaging	Het
Trappc9	A	G	15: 72,693,619	V941A	probably benign	Het
Ugt2b37	A	G	5: 87,240,989	M455T	probably benign	Het
Usp42	A	T	5: 143,726,645	S95T	probably damaging	Het
Usp44	T	C	10: 93,850,187	I488T	possibly damaging	Het
Vmn1r73	T	C	7: 11,756,393	I46T	probably damaging	Het
Vmn2r34	A	T	7: 7,672,541	I616N	probably damaging	Het
Zfp352	A	G	4: 90,224,880	K419R	probably benign	Het
Zfp595	T	A	13: 67,317,647	H187L	probably damaging	Het
Zfp804b	A	T	5: 6,772,161	S301T	probably benign	Het
Zzef1	T	C	11: 72,872,649	V1374A	possibly damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGTAACCAGACAGAGCCC -3'
(R):5'- AATCTGGGATAGGAGACTGCC -3'

Sequencing Primer
(F):5'- ACCTCGGTGACTCAGCC -3'
(R):5'- AAGTGGCAGCTCTTCCCAG -3'

Posted On

2019-05-15