Incidental Mutation 'R7100:Trpc3'
ID 550749
Institutional Source Beutler Lab
Gene Symbol Trpc3
Ensembl Gene ENSMUSG00000027716
Gene Name transient receptor potential cation channel, subfamily C, member 3
Synonyms Trp3, Trcp3, Trrp3
MMRRC Submission 045192-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7100 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36674626-36744276 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36704216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 580 (E580D)
Ref Sequence ENSEMBL: ENSMUSP00000029271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029271]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029271
AA Change: E580D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029271
Gene: ENSMUSG00000027716
AA Change: E580D

DomainStartEndE-ValueType
low complexity region 20 45 N/A INTRINSIC
low complexity region 47 68 N/A INTRINSIC
ANK 100 129 2.47e2 SMART
ANK 135 163 1.97e1 SMART
ANK 221 250 1.13e1 SMART
Pfam:TRP_2 256 318 3e-28 PFAM
transmembrane domain 414 433 N/A INTRINSIC
Pfam:Ion_trans 443 744 4.4e-34 PFAM
Pfam:PKD_channel 486 739 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous knockout mice or mice heterozygoous for a point mutation in exon 7 display an abnormal gait. Abnormal nervous system electrophysiology is also described. An A1903G point mutation in exon 7 results in homozygous lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,394,315 (GRCm39) E89G probably damaging Het
Adgrv1 A T 13: 81,419,016 (GRCm39) V5993E probably damaging Het
Amdhd1 T C 10: 93,372,936 (GRCm39) probably null Het
Amph T C 13: 19,334,011 (GRCm39) *691Q probably null Het
Ankrd55 A G 13: 112,492,644 (GRCm39) K272E probably benign Het
Arhgef10l C T 4: 140,244,126 (GRCm39) V838I possibly damaging Het
Arl2 C A 19: 6,184,774 (GRCm39) V160F probably benign Het
Catsperb T C 12: 101,412,297 (GRCm39) V128A possibly damaging Het
Cdk11b T A 4: 155,710,050 (GRCm39) L17H probably damaging Het
Cpsf1 A T 15: 76,480,314 (GRCm39) N1391K possibly damaging Het
Cpxm2 C T 7: 131,656,544 (GRCm39) A573T probably benign Het
Cspg4b T A 13: 113,455,501 (GRCm39) F516I Het
Daxx T C 17: 34,130,416 (GRCm39) S144P probably damaging Het
Dpp3 T C 19: 4,968,069 (GRCm39) D303G probably damaging Het
Fam181a T A 12: 103,282,132 (GRCm39) N12K probably damaging Het
Flg2 A T 3: 93,111,018 (GRCm39) R1015S unknown Het
Fstl5 A G 3: 76,443,600 (GRCm39) H315R probably benign Het
Fut4 A G 9: 14,662,689 (GRCm39) S202P probably damaging Het
Gm5114 T C 7: 39,057,708 (GRCm39) D637G possibly damaging Het
Gstcd G T 3: 132,790,704 (GRCm39) T21K probably benign Het
Heca C T 10: 17,791,121 (GRCm39) V312M probably benign Het
Herpud1 A G 8: 95,117,475 (GRCm39) R144G probably damaging Het
Hycc2 T A 1: 58,573,653 (GRCm39) T384S possibly damaging Het
Ino80 A G 2: 119,204,994 (GRCm39) S1511P possibly damaging Het
Irf2bp2 T C 8: 127,318,472 (GRCm39) T365A probably benign Het
Klk1 G A 7: 43,878,848 (GRCm39) G214E probably damaging Het
Lama3 A T 18: 12,715,701 (GRCm39) N1719I possibly damaging Het
Lmna A G 3: 88,392,297 (GRCm39) I365T probably damaging Het
Lrp8 C A 4: 107,659,647 (GRCm39) A13E possibly damaging Het
Ly75 A G 2: 60,136,778 (GRCm39) L1483P probably benign Het
Maco1 T C 4: 134,533,971 (GRCm39) D550G probably damaging Het
Mid1 A G X: 168,768,073 (GRCm39) D407G probably benign Het
Mpl G T 4: 118,314,607 (GRCm39) A21E Het
Mus81 C T 19: 5,534,239 (GRCm39) G360S probably damaging Het
Nmt2 T A 2: 3,313,950 (GRCm39) S250T probably benign Het
Nr1d1 C A 11: 98,662,160 (GRCm39) R158L probably damaging Het
Pcgf6 G A 19: 47,039,153 (GRCm39) P36S unknown Het
Pcnx2 G A 8: 126,485,853 (GRCm39) A1915V probably benign Het
Peak1 A G 9: 56,166,677 (GRCm39) V417A probably damaging Het
Phf20l1 A G 15: 66,476,689 (GRCm39) N262S probably benign Het
Plaat5 T A 19: 7,616,923 (GRCm39) F313I unknown Het
Ppp2r5d A G 17: 46,996,608 (GRCm39) V355A probably benign Het
Rasa3 T C 8: 13,636,897 (GRCm39) T395A probably benign Het
Rims1 T A 1: 22,416,697 (GRCm39) I432F probably benign Het
Rnf123 C T 9: 107,933,838 (GRCm39) C1080Y probably damaging Het
Serpina3g T C 12: 104,204,570 (GRCm39) probably benign Het
Shank2 T A 7: 143,964,901 (GRCm39) D836E possibly damaging Het
Slc24a5 A C 2: 124,922,591 (GRCm39) S118R probably damaging Het
Smg1 G T 7: 117,783,743 (GRCm39) H1048N unknown Het
Specc1l T G 10: 75,081,329 (GRCm39) S242A probably benign Het
Tagap1 A T 17: 7,224,111 (GRCm39) L195Q possibly damaging Het
Ttn A T 2: 76,541,166 (GRCm39) V33940E probably benign Het
Upp2 G T 2: 58,681,817 (GRCm39) R318L probably benign Het
Vezt T A 10: 93,832,795 (GRCm39) E205D probably benign Het
Vmn1r177 A G 7: 23,565,535 (GRCm39) F114L probably benign Het
Vmn2r53 C A 7: 12,315,513 (GRCm39) E769* probably null Het
Vnn3 T C 10: 23,741,840 (GRCm39) Y382H probably damaging Het
Other mutations in Trpc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Trpc3 APN 3 36,694,788 (GRCm39) missense possibly damaging 0.95
IGL01701:Trpc3 APN 3 36,725,743 (GRCm39) missense possibly damaging 0.92
IGL02254:Trpc3 APN 3 36,705,669 (GRCm39) missense probably null 0.98
IGL02723:Trpc3 APN 3 36,704,377 (GRCm39) missense probably benign 0.02
IGL02816:Trpc3 APN 3 36,705,851 (GRCm39) missense probably damaging 1.00
IGL02867:Trpc3 APN 3 36,694,850 (GRCm39) missense probably benign 0.10
IGL02929:Trpc3 APN 3 36,692,623 (GRCm39) nonsense probably null
IGL03076:Trpc3 APN 3 36,694,804 (GRCm39) missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36,698,405 (GRCm39) missense probably damaging 1.00
R0032:Trpc3 UTSW 3 36,698,405 (GRCm39) missense probably damaging 1.00
R0115:Trpc3 UTSW 3 36,678,566 (GRCm39) missense probably benign 0.05
R0481:Trpc3 UTSW 3 36,678,566 (GRCm39) missense probably benign 0.05
R0645:Trpc3 UTSW 3 36,725,654 (GRCm39) missense probably benign 0.00
R0694:Trpc3 UTSW 3 36,725,704 (GRCm39) missense possibly damaging 0.48
R1190:Trpc3 UTSW 3 36,725,497 (GRCm39) missense probably benign 0.00
R1635:Trpc3 UTSW 3 36,694,776 (GRCm39) missense probably damaging 1.00
R1828:Trpc3 UTSW 3 36,692,695 (GRCm39) missense possibly damaging 0.95
R2204:Trpc3 UTSW 3 36,704,298 (GRCm39) missense possibly damaging 0.79
R2937:Trpc3 UTSW 3 36,688,532 (GRCm39) nonsense probably null
R3732:Trpc3 UTSW 3 36,692,708 (GRCm39) missense probably benign
R3732:Trpc3 UTSW 3 36,692,708 (GRCm39) missense probably benign
R3733:Trpc3 UTSW 3 36,692,708 (GRCm39) missense probably benign
R4063:Trpc3 UTSW 3 36,725,172 (GRCm39) missense probably damaging 1.00
R4270:Trpc3 UTSW 3 36,717,074 (GRCm39) nonsense probably null
R4807:Trpc3 UTSW 3 36,688,531 (GRCm39) missense probably benign 0.00
R4996:Trpc3 UTSW 3 36,716,967 (GRCm39) missense probably benign 0.00
R5098:Trpc3 UTSW 3 36,717,047 (GRCm39) missense probably benign 0.07
R5139:Trpc3 UTSW 3 36,725,706 (GRCm39) missense possibly damaging 0.46
R5251:Trpc3 UTSW 3 36,725,103 (GRCm39) missense probably damaging 1.00
R5337:Trpc3 UTSW 3 36,692,519 (GRCm39) intron probably benign
R5891:Trpc3 UTSW 3 36,725,171 (GRCm39) missense probably damaging 1.00
R6512:Trpc3 UTSW 3 36,716,907 (GRCm39) missense possibly damaging 0.59
R6618:Trpc3 UTSW 3 36,694,844 (GRCm39) missense possibly damaging 0.82
R6750:Trpc3 UTSW 3 36,678,542 (GRCm39) missense probably damaging 1.00
R6950:Trpc3 UTSW 3 36,692,739 (GRCm39) missense probably damaging 1.00
R6986:Trpc3 UTSW 3 36,709,165 (GRCm39) critical splice donor site probably null
R7031:Trpc3 UTSW 3 36,675,459 (GRCm39) missense probably benign
R7182:Trpc3 UTSW 3 36,709,258 (GRCm39) missense probably benign 0.02
R7211:Trpc3 UTSW 3 36,694,882 (GRCm39) missense possibly damaging 0.81
R7214:Trpc3 UTSW 3 36,704,286 (GRCm39) missense possibly damaging 0.94
R7284:Trpc3 UTSW 3 36,678,562 (GRCm39) missense probably damaging 0.98
R7468:Trpc3 UTSW 3 36,678,565 (GRCm39) missense probably damaging 0.99
R7652:Trpc3 UTSW 3 36,692,677 (GRCm39) missense probably benign 0.06
R7815:Trpc3 UTSW 3 36,709,294 (GRCm39) missense probably benign 0.28
R7833:Trpc3 UTSW 3 36,694,821 (GRCm39) missense probably damaging 0.96
R7977:Trpc3 UTSW 3 36,698,318 (GRCm39) missense probably benign 0.13
R7987:Trpc3 UTSW 3 36,698,318 (GRCm39) missense probably benign 0.13
R8778:Trpc3 UTSW 3 36,725,070 (GRCm39) missense probably damaging 0.99
R8959:Trpc3 UTSW 3 36,709,258 (GRCm39) missense probably benign 0.02
R9072:Trpc3 UTSW 3 36,694,831 (GRCm39) missense probably benign 0.01
R9175:Trpc3 UTSW 3 36,709,279 (GRCm39) missense probably benign 0.15
R9401:Trpc3 UTSW 3 36,675,503 (GRCm39) nonsense probably null
R9429:Trpc3 UTSW 3 36,705,777 (GRCm39) missense probably benign 0.01
R9563:Trpc3 UTSW 3 36,705,683 (GRCm39) missense probably benign 0.03
R9571:Trpc3 UTSW 3 36,694,909 (GRCm39) missense probably damaging 1.00
R9711:Trpc3 UTSW 3 36,692,713 (GRCm39) missense possibly damaging 0.81
Z1177:Trpc3 UTSW 3 36,675,428 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAAGATCACAGAGTTTGTAGGGTTTG -3'
(R):5'- TCTGAGTGCAAGGAGCTGTG -3'

Sequencing Primer
(F):5'- GATTCTATCCGTGGTTTCAGGAATC -3'
(R):5'- GCTGTGGCTGGAGGGGC -3'
Posted On 2019-05-15