Incidental Mutation 'R7100:Fstl5'
ID550750
Institutional Source Beutler Lab
Gene Symbol Fstl5
Ensembl Gene ENSMUSG00000034098
Gene Namefollistatin-like 5
Synonyms9130207J01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7100 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location76074270-76710019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76536293 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 315 (H315R)
Ref Sequence ENSEMBL: ENSMUSP00000038506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038364] [ENSMUST00000160261]
Predicted Effect probably benign
Transcript: ENSMUST00000038364
AA Change: H315R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038506
Gene: ENSMUSG00000034098
AA Change: H315R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160261
AA Change: H315R

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125393
Gene: ENSMUSG00000034098
AA Change: H315R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
KAZAL 88 133 2.16e-9 SMART
IGc2 261 328 1.11e-5 SMART
IGc2 353 420 3.85e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,552,395 E89G probably damaging Het
Adgrv1 A T 13: 81,270,897 V5993E probably damaging Het
Amdhd1 T C 10: 93,537,074 probably null Het
Amph T C 13: 19,149,841 *691Q probably null Het
Ankrd55 A G 13: 112,356,110 K272E probably benign Het
Arhgef10l C T 4: 140,516,815 V838I possibly damaging Het
Arl2 C A 19: 6,134,744 V160F probably benign Het
BC067074 T A 13: 113,318,967 F516I Het
Catsperb T C 12: 101,446,038 V128A possibly damaging Het
Cdk11b T A 4: 155,625,593 L17H probably damaging Het
Cpsf1 A T 15: 76,596,114 N1391K possibly damaging Het
Cpxm2 C T 7: 132,054,815 A573T probably benign Het
Daxx T C 17: 33,911,442 S144P probably damaging Het
Dpp3 T C 19: 4,918,041 D303G probably damaging Het
Fam126b T A 1: 58,534,494 T384S possibly damaging Het
Fam181a T A 12: 103,315,873 N12K probably damaging Het
Flg2 A T 3: 93,203,711 R1015S unknown Het
Fut4 A G 9: 14,751,393 S202P probably damaging Het
Gm5114 T C 7: 39,408,284 D637G possibly damaging Het
Gstcd G T 3: 133,084,943 T21K probably benign Het
Heca C T 10: 17,915,373 V312M probably benign Het
Herpud1 A G 8: 94,390,847 R144G probably damaging Het
Hrasls5 T A 19: 7,639,558 F313I unknown Het
Ino80 A G 2: 119,374,513 S1511P possibly damaging Het
Irf2bp2 T C 8: 126,591,733 T365A probably benign Het
Klk1 G A 7: 44,229,424 G214E probably damaging Het
Lama3 A T 18: 12,582,644 N1719I possibly damaging Het
Lmna A G 3: 88,484,990 I365T probably damaging Het
Lrp8 C A 4: 107,802,450 A13E possibly damaging Het
Ly75 A G 2: 60,306,434 L1483P probably benign Het
Mid1 A G X: 169,985,077 D407G probably benign Het
Mpl G T 4: 118,457,410 A21E Het
Mus81 C T 19: 5,484,211 G360S probably damaging Het
Nmt2 T A 2: 3,312,913 S250T probably benign Het
Nr1d1 C A 11: 98,771,334 R158L probably damaging Het
Pcgf6 G A 19: 47,050,714 P36S unknown Het
Pcnx2 G A 8: 125,759,114 A1915V probably benign Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Phf20l1 A G 15: 66,604,840 N262S probably benign Het
Ppp2r5d A G 17: 46,685,682 V355A probably benign Het
Rasa3 T C 8: 13,586,897 T395A probably benign Het
Rims1 T A 1: 22,346,473 I432F probably benign Het
Rnf123 C T 9: 108,056,639 C1080Y probably damaging Het
Serpina3g T C 12: 104,238,311 probably benign Het
Shank2 T A 7: 144,411,164 D836E possibly damaging Het
Slc24a5 A C 2: 125,080,671 S118R probably damaging Het
Smg1 G T 7: 118,184,520 H1048N unknown Het
Specc1l T G 10: 75,245,495 S242A probably benign Het
Tagap1 A T 17: 6,956,712 L195Q possibly damaging Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Trpc3 C A 3: 36,650,067 E580D probably benign Het
Ttn A T 2: 76,710,822 V33940E probably benign Het
Upp2 G T 2: 58,791,805 R318L probably benign Het
Vezt T A 10: 93,996,933 E205D probably benign Het
Vmn1r177 A G 7: 23,866,110 F114L probably benign Het
Vmn2r53 C A 7: 12,581,586 E769* probably null Het
Vnn3 T C 10: 23,865,942 Y382H probably damaging Het
Other mutations in Fstl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Fstl5 APN 3 76707828 missense probably benign 0.30
IGL01658:Fstl5 APN 3 76482255 missense possibly damaging 0.70
IGL01917:Fstl5 APN 3 76707846 missense probably damaging 1.00
IGL02073:Fstl5 APN 3 76659652 splice site probably benign
IGL02329:Fstl5 APN 3 76588995 missense probably damaging 1.00
IGL02651:Fstl5 APN 3 76593534 missense probably damaging 1.00
IGL02967:Fstl5 APN 3 76322191 missense probably damaging 1.00
IGL03004:Fstl5 APN 3 76648431 splice site probably benign
IGL03107:Fstl5 APN 3 76536311 missense probably damaging 1.00
IGL03113:Fstl5 APN 3 76429792 nonsense probably null
P0038:Fstl5 UTSW 3 76145062 missense probably damaging 1.00
PIT4131001:Fstl5 UTSW 3 76659699 missense probably damaging 0.99
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0015:Fstl5 UTSW 3 76322191 missense probably damaging 1.00
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0032:Fstl5 UTSW 3 76648435 splice site probably benign
R0078:Fstl5 UTSW 3 76659645 splice site probably benign
R0137:Fstl5 UTSW 3 76707479 missense probably damaging 1.00
R0183:Fstl5 UTSW 3 76322272 missense possibly damaging 0.86
R0330:Fstl5 UTSW 3 76707753 missense possibly damaging 0.80
R0427:Fstl5 UTSW 3 76707727 nonsense probably null
R0687:Fstl5 UTSW 3 76707812 missense possibly damaging 0.62
R1642:Fstl5 UTSW 3 76410622 missense possibly damaging 0.80
R1765:Fstl5 UTSW 3 76593476 missense possibly damaging 0.90
R1900:Fstl5 UTSW 3 76708160 missense probably damaging 1.00
R1996:Fstl5 UTSW 3 76707834 missense probably benign 0.19
R2157:Fstl5 UTSW 3 76708065 missense possibly damaging 0.46
R2228:Fstl5 UTSW 3 76482352 missense probably damaging 1.00
R2851:Fstl5 UTSW 3 76429738 splice site probably benign
R4021:Fstl5 UTSW 3 76628975 missense probably benign 0.00
R4086:Fstl5 UTSW 3 76648286 missense probably damaging 1.00
R4777:Fstl5 UTSW 3 76593500 missense probably damaging 1.00
R4829:Fstl5 UTSW 3 76322182 missense probably damaging 1.00
R4934:Fstl5 UTSW 3 76588965 missense probably damaging 1.00
R4955:Fstl5 UTSW 3 76223876 critical splice donor site probably null
R4977:Fstl5 UTSW 3 76410494 nonsense probably null
R5166:Fstl5 UTSW 3 76628960 missense possibly damaging 0.86
R5232:Fstl5 UTSW 3 76144977 missense possibly damaging 0.89
R5313:Fstl5 UTSW 3 76593505 missense possibly damaging 0.90
R5584:Fstl5 UTSW 3 76322267 missense probably damaging 1.00
R5647:Fstl5 UTSW 3 76589092 missense probably damaging 1.00
R5842:Fstl5 UTSW 3 76322283 missense possibly damaging 0.94
R5978:Fstl5 UTSW 3 76145085 missense probably damaging 1.00
R6007:Fstl5 UTSW 3 76410592 missense probably damaging 1.00
R6064:Fstl5 UTSW 3 76322298 missense probably benign 0.13
R6327:Fstl5 UTSW 3 76707801 missense probably benign 0.31
R6386:Fstl5 UTSW 3 76322066 missense probably benign 0.13
R6523:Fstl5 UTSW 3 76536334 missense probably benign 0.00
R6852:Fstl5 UTSW 3 76707855 missense probably damaging 1.00
R6861:Fstl5 UTSW 3 76322216 missense probably damaging 1.00
R6866:Fstl5 UTSW 3 76322225 missense probably damaging 0.99
R7341:Fstl5 UTSW 3 76482397 splice site probably null
R7495:Fstl5 UTSW 3 76707792 missense possibly damaging 0.85
R7558:Fstl5 UTSW 3 76429785 missense possibly damaging 0.95
R7731:Fstl5 UTSW 3 76661762 missense probably damaging 1.00
R7787:Fstl5 UTSW 3 76429824 missense probably damaging 1.00
R7852:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7874:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7881:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R7935:Fstl5 UTSW 3 76707968 missense probably benign 0.00
R7957:Fstl5 UTSW 3 76661786 missense probably benign 0.10
R7964:Fstl5 UTSW 3 76536298 missense probably damaging 1.00
R8039:Fstl5 UTSW 3 76648418 missense possibly damaging 0.69
R8050:Fstl5 UTSW 3 76707503 missense probably benign 0.00
Z1176:Fstl5 UTSW 3 76707982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGGAGTATTTATCAGTGAAAGC -3'
(R):5'- GTGTTAATCAGGTGGGATCTTAAAAG -3'

Sequencing Primer
(F):5'- TGCTCGTGAACATAAGTGA -3'
(R):5'- AGGTACTGTCTAGTCCACTG -3'
Posted On2019-05-15