Incidental Mutation 'R7100:Tmem57'
ID550756
Institutional Source Beutler Lab
Gene Symbol Tmem57
Ensembl Gene ENSMUSG00000028826
Gene Nametransmembrane protein 57
Synonyms1110007C24Rik, C61, 9230118A01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R7100 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134802759-134853345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134806660 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 550 (D550G)
Ref Sequence ENSEMBL: ENSMUSP00000030628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030628] [ENSMUST00000137707]
Predicted Effect probably damaging
Transcript: ENSMUST00000030628
AA Change: D550G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030628
Gene: ENSMUSG00000028826
AA Change: D550G

DomainStartEndE-ValueType
Pfam:Macoilin 2 662 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137707
SMART Domains Protein: ENSMUSP00000124477
Gene: ENSMUSG00000028826

DomainStartEndE-ValueType
Pfam:Macoilin 2 157 2.1e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150031
Meta Mutation Damage Score 0.4940 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,552,395 E89G probably damaging Het
Adgrv1 A T 13: 81,270,897 V5993E probably damaging Het
Amdhd1 T C 10: 93,537,074 probably null Het
Amph T C 13: 19,149,841 *691Q probably null Het
Ankrd55 A G 13: 112,356,110 K272E probably benign Het
Arhgef10l C T 4: 140,516,815 V838I possibly damaging Het
Arl2 C A 19: 6,134,744 V160F probably benign Het
BC067074 T A 13: 113,318,967 F516I Het
Catsperb T C 12: 101,446,038 V128A possibly damaging Het
Cdk11b T A 4: 155,625,593 L17H probably damaging Het
Cpsf1 A T 15: 76,596,114 N1391K possibly damaging Het
Cpxm2 C T 7: 132,054,815 A573T probably benign Het
Daxx T C 17: 33,911,442 S144P probably damaging Het
Dpp3 T C 19: 4,918,041 D303G probably damaging Het
Fam126b T A 1: 58,534,494 T384S possibly damaging Het
Fam181a T A 12: 103,315,873 N12K probably damaging Het
Flg2 A T 3: 93,203,711 R1015S unknown Het
Fstl5 A G 3: 76,536,293 H315R probably benign Het
Fut4 A G 9: 14,751,393 S202P probably damaging Het
Gm5114 T C 7: 39,408,284 D637G possibly damaging Het
Gstcd G T 3: 133,084,943 T21K probably benign Het
Heca C T 10: 17,915,373 V312M probably benign Het
Herpud1 A G 8: 94,390,847 R144G probably damaging Het
Hrasls5 T A 19: 7,639,558 F313I unknown Het
Ino80 A G 2: 119,374,513 S1511P possibly damaging Het
Irf2bp2 T C 8: 126,591,733 T365A probably benign Het
Klk1 G A 7: 44,229,424 G214E probably damaging Het
Lama3 A T 18: 12,582,644 N1719I possibly damaging Het
Lmna A G 3: 88,484,990 I365T probably damaging Het
Lrp8 C A 4: 107,802,450 A13E possibly damaging Het
Ly75 A G 2: 60,306,434 L1483P probably benign Het
Mid1 A G X: 169,985,077 D407G probably benign Het
Mpl G T 4: 118,457,410 A21E Het
Mus81 C T 19: 5,484,211 G360S probably damaging Het
Nmt2 T A 2: 3,312,913 S250T probably benign Het
Nr1d1 C A 11: 98,771,334 R158L probably damaging Het
Pcgf6 G A 19: 47,050,714 P36S unknown Het
Pcnx2 G A 8: 125,759,114 A1915V probably benign Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Phf20l1 A G 15: 66,604,840 N262S probably benign Het
Ppp2r5d A G 17: 46,685,682 V355A probably benign Het
Rasa3 T C 8: 13,586,897 T395A probably benign Het
Rims1 T A 1: 22,346,473 I432F probably benign Het
Rnf123 C T 9: 108,056,639 C1080Y probably damaging Het
Serpina3g T C 12: 104,238,311 probably benign Het
Shank2 T A 7: 144,411,164 D836E possibly damaging Het
Slc24a5 A C 2: 125,080,671 S118R probably damaging Het
Smg1 G T 7: 118,184,520 H1048N unknown Het
Specc1l T G 10: 75,245,495 S242A probably benign Het
Tagap1 A T 17: 6,956,712 L195Q possibly damaging Het
Trpc3 C A 3: 36,650,067 E580D probably benign Het
Ttn A T 2: 76,710,822 V33940E probably benign Het
Upp2 G T 2: 58,791,805 R318L probably benign Het
Vezt T A 10: 93,996,933 E205D probably benign Het
Vmn1r177 A G 7: 23,866,110 F114L probably benign Het
Vmn2r53 C A 7: 12,581,586 E769* probably null Het
Vnn3 T C 10: 23,865,942 Y382H probably damaging Het
Other mutations in Tmem57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Tmem57 APN 4 134828206 missense probably damaging 0.96
IGL01062:Tmem57 APN 4 134833297 missense probably damaging 0.97
IGL02249:Tmem57 APN 4 134828312 missense possibly damaging 0.50
IGL02850:Tmem57 APN 4 134828386 missense probably benign 0.12
subtle UTSW 4 134828299 missense probably damaging 1.00
R0400:Tmem57 UTSW 4 134828116 missense probably benign 0.25
R0548:Tmem57 UTSW 4 134806660 missense probably damaging 1.00
R0589:Tmem57 UTSW 4 134828217 missense probably benign 0.30
R1536:Tmem57 UTSW 4 134804507 missense probably damaging 1.00
R2063:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R2151:Tmem57 UTSW 4 134811223 missense probably benign 0.00
R2509:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2510:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R2511:Tmem57 UTSW 4 134804388 missense probably damaging 1.00
R3806:Tmem57 UTSW 4 134830580 missense probably benign 0.00
R3946:Tmem57 UTSW 4 134804481 missense probably damaging 1.00
R4994:Tmem57 UTSW 4 134828299 missense probably damaging 1.00
R4999:Tmem57 UTSW 4 134828133 missense probably benign 0.23
R5169:Tmem57 UTSW 4 134828463 missense probably benign 0.23
R5310:Tmem57 UTSW 4 134837019 intron probably benign
R5443:Tmem57 UTSW 4 134833308 nonsense probably null
R5554:Tmem57 UTSW 4 134828134 missense probably benign
R5712:Tmem57 UTSW 4 134828058 missense probably benign 0.06
R6627:Tmem57 UTSW 4 134836343 missense probably damaging 0.98
R7448:Tmem57 UTSW 4 134828279 missense possibly damaging 0.95
R8059:Tmem57 UTSW 4 134828048 nonsense probably null
R8300:Tmem57 UTSW 4 134828451 missense probably benign
X0062:Tmem57 UTSW 4 134836347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCGGTTCAGAGCTCTTGG -3'
(R):5'- AACACACAGGGTATCAGGATTC -3'

Sequencing Primer
(F):5'- GGGAGGTCCATTCCATGTATCAC -3'
(R):5'- AGGATTCTCTGTCCTAATGGCCAG -3'
Posted On2019-05-15