Incidental Mutation 'R7100:Vmn2r53'
ID 550759
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 045192-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R7100 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12315397-12342583 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 12315513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 769 (E769*)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably null
Transcript: ENSMUST00000170412
AA Change: E769*
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: E769*

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,394,315 (GRCm39) E89G probably damaging Het
Adgrv1 A T 13: 81,419,016 (GRCm39) V5993E probably damaging Het
Amdhd1 T C 10: 93,372,936 (GRCm39) probably null Het
Amph T C 13: 19,334,011 (GRCm39) *691Q probably null Het
Ankrd55 A G 13: 112,492,644 (GRCm39) K272E probably benign Het
Arhgef10l C T 4: 140,244,126 (GRCm39) V838I possibly damaging Het
Arl2 C A 19: 6,184,774 (GRCm39) V160F probably benign Het
Catsperb T C 12: 101,412,297 (GRCm39) V128A possibly damaging Het
Cdk11b T A 4: 155,710,050 (GRCm39) L17H probably damaging Het
Cpsf1 A T 15: 76,480,314 (GRCm39) N1391K possibly damaging Het
Cpxm2 C T 7: 131,656,544 (GRCm39) A573T probably benign Het
Cspg4b T A 13: 113,455,501 (GRCm39) F516I Het
Daxx T C 17: 34,130,416 (GRCm39) S144P probably damaging Het
Dpp3 T C 19: 4,968,069 (GRCm39) D303G probably damaging Het
Fam181a T A 12: 103,282,132 (GRCm39) N12K probably damaging Het
Flg2 A T 3: 93,111,018 (GRCm39) R1015S unknown Het
Fstl5 A G 3: 76,443,600 (GRCm39) H315R probably benign Het
Fut4 A G 9: 14,662,689 (GRCm39) S202P probably damaging Het
Gm5114 T C 7: 39,057,708 (GRCm39) D637G possibly damaging Het
Gstcd G T 3: 132,790,704 (GRCm39) T21K probably benign Het
Heca C T 10: 17,791,121 (GRCm39) V312M probably benign Het
Herpud1 A G 8: 95,117,475 (GRCm39) R144G probably damaging Het
Hycc2 T A 1: 58,573,653 (GRCm39) T384S possibly damaging Het
Ino80 A G 2: 119,204,994 (GRCm39) S1511P possibly damaging Het
Irf2bp2 T C 8: 127,318,472 (GRCm39) T365A probably benign Het
Klk1 G A 7: 43,878,848 (GRCm39) G214E probably damaging Het
Lama3 A T 18: 12,715,701 (GRCm39) N1719I possibly damaging Het
Lmna A G 3: 88,392,297 (GRCm39) I365T probably damaging Het
Lrp8 C A 4: 107,659,647 (GRCm39) A13E possibly damaging Het
Ly75 A G 2: 60,136,778 (GRCm39) L1483P probably benign Het
Maco1 T C 4: 134,533,971 (GRCm39) D550G probably damaging Het
Mid1 A G X: 168,768,073 (GRCm39) D407G probably benign Het
Mpl G T 4: 118,314,607 (GRCm39) A21E Het
Mus81 C T 19: 5,534,239 (GRCm39) G360S probably damaging Het
Nmt2 T A 2: 3,313,950 (GRCm39) S250T probably benign Het
Nr1d1 C A 11: 98,662,160 (GRCm39) R158L probably damaging Het
Pcgf6 G A 19: 47,039,153 (GRCm39) P36S unknown Het
Pcnx2 G A 8: 126,485,853 (GRCm39) A1915V probably benign Het
Peak1 A G 9: 56,166,677 (GRCm39) V417A probably damaging Het
Phf20l1 A G 15: 66,476,689 (GRCm39) N262S probably benign Het
Plaat5 T A 19: 7,616,923 (GRCm39) F313I unknown Het
Ppp2r5d A G 17: 46,996,608 (GRCm39) V355A probably benign Het
Rasa3 T C 8: 13,636,897 (GRCm39) T395A probably benign Het
Rims1 T A 1: 22,416,697 (GRCm39) I432F probably benign Het
Rnf123 C T 9: 107,933,838 (GRCm39) C1080Y probably damaging Het
Serpina3g T C 12: 104,204,570 (GRCm39) probably benign Het
Shank2 T A 7: 143,964,901 (GRCm39) D836E possibly damaging Het
Slc24a5 A C 2: 124,922,591 (GRCm39) S118R probably damaging Het
Smg1 G T 7: 117,783,743 (GRCm39) H1048N unknown Het
Specc1l T G 10: 75,081,329 (GRCm39) S242A probably benign Het
Tagap1 A T 17: 7,224,111 (GRCm39) L195Q possibly damaging Het
Trpc3 C A 3: 36,704,216 (GRCm39) E580D probably benign Het
Ttn A T 2: 76,541,166 (GRCm39) V33940E probably benign Het
Upp2 G T 2: 58,681,817 (GRCm39) R318L probably benign Het
Vezt T A 10: 93,832,795 (GRCm39) E205D probably benign Het
Vmn1r177 A G 7: 23,565,535 (GRCm39) F114L probably benign Het
Vnn3 T C 10: 23,741,840 (GRCm39) Y382H probably damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12,334,835 (GRCm39) missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12,316,373 (GRCm39) missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12,315,656 (GRCm39) missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12,316,288 (GRCm39) missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12,315,872 (GRCm39) missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12,315,393 (GRCm39) unclassified probably benign
IGL03064:Vmn2r53 APN 7 12,334,937 (GRCm39) missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12,334,791 (GRCm39) missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12,340,435 (GRCm39) missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12,340,318 (GRCm39) missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12,315,819 (GRCm39) missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12,332,349 (GRCm39) missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12,315,993 (GRCm39) missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12,316,338 (GRCm39) missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12,315,707 (GRCm39) missense probably benign
R0881:Vmn2r53 UTSW 7 12,334,859 (GRCm39) missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12,335,141 (GRCm39) missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12,315,429 (GRCm39) missense probably benign
R1102:Vmn2r53 UTSW 7 12,332,410 (GRCm39) missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12,334,673 (GRCm39) missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12,315,533 (GRCm39) missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12,318,701 (GRCm39) missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12,315,632 (GRCm39) missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12,334,812 (GRCm39) missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12,332,438 (GRCm39) missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12,335,366 (GRCm39) missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12,315,981 (GRCm39) missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12,315,656 (GRCm39) missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12,316,229 (GRCm39) missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12,315,932 (GRCm39) missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12,334,901 (GRCm39) missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4710:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4774:Vmn2r53 UTSW 7 12,334,692 (GRCm39) nonsense probably null
R4859:Vmn2r53 UTSW 7 12,335,330 (GRCm39) missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12,315,741 (GRCm39) missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12,335,347 (GRCm39) missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12,334,733 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12,316,328 (GRCm39) missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12,315,808 (GRCm39) missense probably benign
R6312:Vmn2r53 UTSW 7 12,332,566 (GRCm39) critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12,315,633 (GRCm39) missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12,335,360 (GRCm39) missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12,340,441 (GRCm39) missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12,335,069 (GRCm39) missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12,316,343 (GRCm39) missense probably benign 0.19
R7174:Vmn2r53 UTSW 7 12,315,628 (GRCm39) missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12,334,983 (GRCm39) missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12,340,359 (GRCm39) missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12,315,846 (GRCm39) missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12,332,425 (GRCm39) missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12,340,418 (GRCm39) missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12,316,026 (GRCm39) missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12,335,322 (GRCm39) missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12,315,843 (GRCm39) missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12,340,281 (GRCm39) missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12,315,737 (GRCm39) missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12,334,752 (GRCm39) missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12,315,926 (GRCm39) missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12,315,435 (GRCm39) missense probably benign
R9076:Vmn2r53 UTSW 7 12,340,231 (GRCm39) missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12,335,124 (GRCm39) missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12,315,912 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12,335,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTCATTTGTGTTTTGTCCTAAG -3'
(R):5'- ATGTCTTCAATGAGACCAAGTTCC -3'

Sequencing Primer
(F):5'- AGTATCTCACTTGATCTGTCTTTCAG -3'
(R):5'- TGAGACCAAGTTCCTCACCTTCAG -3'
Posted On 2019-05-15