Incidental Mutation 'R7100:Vmn2r53'
ID550759
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Namevomeronasal 2, receptor 53
SynonymsEG637908
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7100 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12581470-12606544 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 12581586 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 769 (E769*)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
Predicted Effect probably null
Transcript: ENSMUST00000170412
AA Change: E769*
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: E769*

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,552,395 E89G probably damaging Het
Adgrv1 A T 13: 81,270,897 V5993E probably damaging Het
Amdhd1 T C 10: 93,537,074 probably null Het
Amph T C 13: 19,149,841 *691Q probably null Het
Ankrd55 A G 13: 112,356,110 K272E probably benign Het
Arhgef10l C T 4: 140,516,815 V838I possibly damaging Het
Arl2 C A 19: 6,134,744 V160F probably benign Het
BC067074 T A 13: 113,318,967 F516I Het
Catsperb T C 12: 101,446,038 V128A possibly damaging Het
Cdk11b T A 4: 155,625,593 L17H probably damaging Het
Cpsf1 A T 15: 76,596,114 N1391K possibly damaging Het
Cpxm2 C T 7: 132,054,815 A573T probably benign Het
Daxx T C 17: 33,911,442 S144P probably damaging Het
Dpp3 T C 19: 4,918,041 D303G probably damaging Het
Fam126b T A 1: 58,534,494 T384S possibly damaging Het
Fam181a T A 12: 103,315,873 N12K probably damaging Het
Flg2 A T 3: 93,203,711 R1015S unknown Het
Fstl5 A G 3: 76,536,293 H315R probably benign Het
Fut4 A G 9: 14,751,393 S202P probably damaging Het
Gm5114 T C 7: 39,408,284 D637G possibly damaging Het
Gstcd G T 3: 133,084,943 T21K probably benign Het
Heca C T 10: 17,915,373 V312M probably benign Het
Herpud1 A G 8: 94,390,847 R144G probably damaging Het
Hrasls5 T A 19: 7,639,558 F313I unknown Het
Ino80 A G 2: 119,374,513 S1511P possibly damaging Het
Irf2bp2 T C 8: 126,591,733 T365A probably benign Het
Klk1 G A 7: 44,229,424 G214E probably damaging Het
Lama3 A T 18: 12,582,644 N1719I possibly damaging Het
Lmna A G 3: 88,484,990 I365T probably damaging Het
Lrp8 C A 4: 107,802,450 A13E possibly damaging Het
Ly75 A G 2: 60,306,434 L1483P probably benign Het
Mid1 A G X: 169,985,077 D407G probably benign Het
Mpl G T 4: 118,457,410 A21E Het
Mus81 C T 19: 5,484,211 G360S probably damaging Het
Nmt2 T A 2: 3,312,913 S250T probably benign Het
Nr1d1 C A 11: 98,771,334 R158L probably damaging Het
Pcgf6 G A 19: 47,050,714 P36S unknown Het
Pcnx2 G A 8: 125,759,114 A1915V probably benign Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Phf20l1 A G 15: 66,604,840 N262S probably benign Het
Ppp2r5d A G 17: 46,685,682 V355A probably benign Het
Rasa3 T C 8: 13,586,897 T395A probably benign Het
Rims1 T A 1: 22,346,473 I432F probably benign Het
Rnf123 C T 9: 108,056,639 C1080Y probably damaging Het
Serpina3g T C 12: 104,238,311 probably benign Het
Shank2 T A 7: 144,411,164 D836E possibly damaging Het
Slc24a5 A C 2: 125,080,671 S118R probably damaging Het
Smg1 G T 7: 118,184,520 H1048N unknown Het
Specc1l T G 10: 75,245,495 S242A probably benign Het
Tagap1 A T 17: 6,956,712 L195Q possibly damaging Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Trpc3 C A 3: 36,650,067 E580D probably benign Het
Ttn A T 2: 76,710,822 V33940E probably benign Het
Upp2 G T 2: 58,791,805 R318L probably benign Het
Vezt T A 10: 93,996,933 E205D probably benign Het
Vmn1r177 A G 7: 23,866,110 F114L probably benign Het
Vnn3 T C 10: 23,865,942 Y382H probably damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12600908 missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12582446 missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12581729 missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12582361 missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12581945 missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12581466 unclassified probably benign
IGL03064:Vmn2r53 APN 7 12601010 missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12600864 missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12606508 missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12606391 missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12581892 missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12598422 missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12582066 missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12582411 missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12581780 missense probably benign
R0881:Vmn2r53 UTSW 7 12600932 missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12601214 missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12601392 missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12581502 missense probably benign
R1102:Vmn2r53 UTSW 7 12598483 missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12600746 missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12581606 missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12584774 missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12581705 missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12600885 missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12598511 missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12601439 missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12582054 missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12581729 missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12582302 missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12582005 missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12600974 missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12601202 missense probably benign
R4710:Vmn2r53 UTSW 7 12601202 missense probably benign
R4774:Vmn2r53 UTSW 7 12600765 nonsense probably null
R4859:Vmn2r53 UTSW 7 12601403 missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12581814 missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12601420 missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12600806 missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12582401 missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12581881 missense probably benign
R6312:Vmn2r53 UTSW 7 12598639 critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12581706 missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12601433 missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12606514 missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12601142 missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12582416 missense probably benign 0.19
R7174:Vmn2r53 UTSW 7 12581701 missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12601056 missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12606432 missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12581919 missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12598498 missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12606491 missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12582099 missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12601395 missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12581916 missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12606354 missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12581810 missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12600825 missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12581999 missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12601304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTCATTTGTGTTTTGTCCTAAG -3'
(R):5'- ATGTCTTCAATGAGACCAAGTTCC -3'

Sequencing Primer
(F):5'- AGTATCTCACTTGATCTGTCTTTCAG -3'
(R):5'- TGAGACCAAGTTCCTCACCTTCAG -3'
Posted On2019-05-15