Mutagenetix > Incidental Mutation

Incidental Mutation 'R7100:Shank2'

550765

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

045192-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7100 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144411164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 836 (D836E)

Ref Sequence

ENSEMBL: ENSMUSP00000146440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000097929
AA Change: D829E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: D829E

Domain	Start	End	E-Value	Type
PDZ	46	131	1.75e-14	SMART
low complexity region	135	154	N/A	INTRINSIC
low complexity region	299	314	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	539	550	N/A	INTRINSIC
low complexity region	570	582	N/A	INTRINSIC
low complexity region	619	637	N/A	INTRINSIC
low complexity region	814	828	N/A	INTRINSIC
low complexity region	883	894	N/A	INTRINSIC
low complexity region	915	937	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	989	997	N/A	INTRINSIC
low complexity region	1077	1091	N/A	INTRINSIC
low complexity region	1134	1149	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
SAM	1196	1262	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105900
AA Change: D1046E

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: D1046E

Domain	Start	End	E-Value	Type
SH3	150	205	1.04e-14	SMART
PDZ	256	341	1.75e-14	SMART
low complexity region	345	364	N/A	INTRINSIC
low complexity region	509	524	N/A	INTRINSIC
low complexity region	662	674	N/A	INTRINSIC
low complexity region	749	760	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	829	847	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1093	1104	N/A	INTRINSIC
low complexity region	1125	1147	N/A	INTRINSIC
low complexity region	1161	1177	N/A	INTRINSIC
low complexity region	1199	1207	N/A	INTRINSIC
low complexity region	1287	1301	N/A	INTRINSIC
low complexity region	1344	1359	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
SAM	1406	1472	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105902
AA Change: D1415E

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: D1415E

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146006
AA Change: D836E

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl10	A	G	2: 154,552,395	E89G	probably damaging	Het
Adgrv1	A	T	13: 81,270,897	V5993E	probably damaging	Het
Amdhd1	T	C	10: 93,537,074		probably null	Het
Amph	T	C	13: 19,149,841	*691Q	probably null	Het
Ankrd55	A	G	13: 112,356,110	K272E	probably benign	Het
Arhgef10l	C	T	4: 140,516,815	V838I	possibly damaging	Het
Arl2	C	A	19: 6,134,744	V160F	probably benign	Het
BC067074	T	A	13: 113,318,967	F516I		Het
Catsperb	T	C	12: 101,446,038	V128A	possibly damaging	Het
Cdk11b	T	A	4: 155,625,593	L17H	probably damaging	Het
Cpsf1	A	T	15: 76,596,114	N1391K	possibly damaging	Het
Cpxm2	C	T	7: 132,054,815	A573T	probably benign	Het
Daxx	T	C	17: 33,911,442	S144P	probably damaging	Het
Dpp3	T	C	19: 4,918,041	D303G	probably damaging	Het
Fam126b	T	A	1: 58,534,494	T384S	possibly damaging	Het
Fam181a	T	A	12: 103,315,873	N12K	probably damaging	Het
Flg2	A	T	3: 93,203,711	R1015S	unknown	Het
Fstl5	A	G	3: 76,536,293	H315R	probably benign	Het
Fut4	A	G	9: 14,751,393	S202P	probably damaging	Het
Gm5114	T	C	7: 39,408,284	D637G	possibly damaging	Het
Gstcd	G	T	3: 133,084,943	T21K	probably benign	Het
Heca	C	T	10: 17,915,373	V312M	probably benign	Het
Herpud1	A	G	8: 94,390,847	R144G	probably damaging	Het
Hrasls5	T	A	19: 7,639,558	F313I	unknown	Het
Ino80	A	G	2: 119,374,513	S1511P	possibly damaging	Het
Irf2bp2	T	C	8: 126,591,733	T365A	probably benign	Het
Klk1	G	A	7: 44,229,424	G214E	probably damaging	Het
Lama3	A	T	18: 12,582,644	N1719I	possibly damaging	Het
Lmna	A	G	3: 88,484,990	I365T	probably damaging	Het
Lrp8	C	A	4: 107,802,450	A13E	possibly damaging	Het
Ly75	A	G	2: 60,306,434	L1483P	probably benign	Het
Mid1	A	G	X: 169,985,077	D407G	probably benign	Het
Mpl	G	T	4: 118,457,410	A21E		Het
Mus81	C	T	19: 5,484,211	G360S	probably damaging	Het
Nmt2	T	A	2: 3,312,913	S250T	probably benign	Het
Nr1d1	C	A	11: 98,771,334	R158L	probably damaging	Het
Pcgf6	G	A	19: 47,050,714	P36S	unknown	Het
Pcnx2	G	A	8: 125,759,114	A1915V	probably benign	Het
Peak1	A	G	9: 56,259,393	V417A	probably damaging	Het
Phf20l1	A	G	15: 66,604,840	N262S	probably benign	Het
Ppp2r5d	A	G	17: 46,685,682	V355A	probably benign	Het
Rasa3	T	C	8: 13,586,897	T395A	probably benign	Het
Rims1	T	A	1: 22,346,473	I432F	probably benign	Het
Rnf123	C	T	9: 108,056,639	C1080Y	probably damaging	Het
Serpina3g	T	C	12: 104,238,311		probably benign	Het
Slc24a5	A	C	2: 125,080,671	S118R	probably damaging	Het
Smg1	G	T	7: 118,184,520	H1048N	unknown	Het
Specc1l	T	G	10: 75,245,495	S242A	probably benign	Het
Tagap1	A	T	17: 6,956,712	L195Q	possibly damaging	Het
Tmem57	T	C	4: 134,806,660	D550G	probably damaging	Het
Trpc3	C	A	3: 36,650,067	E580D	probably benign	Het
Ttn	A	T	2: 76,710,822	V33940E	probably benign	Het
Upp2	G	T	2: 58,791,805	R318L	probably benign	Het
Vezt	T	A	10: 93,996,933	E205D	probably benign	Het
Vmn1r177	A	G	7: 23,866,110	F114L	probably benign	Het
Vmn2r53	C	A	7: 12,581,586	E769*	probably null	Het
Vnn3	T	C	10: 23,865,942	Y382H	probably damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	144052306	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	144410446	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	144410110	missense	probably benign	0.00
R9559:Shank2	UTSW	7	144031304	missense	probably benign	0.30
R9574:Shank2	UTSW	7	144068725	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	144411100	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	144128400	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCGTTCCCAAAACCGAAG -3'
(R):5'- GGTGACTGCATCGAAACTTTC -3'

Sequencing Primer
(F):5'- CGAAGGTGCTTTACAGATCTCCG -3'
(R):5'- TGGCTGGAGTTCAACGTA -3'

Posted On

2019-05-15