Mutagenetix > Incidental Mutation

Incidental Mutation 'R7100:Rasa3'

550766

Institutional Source

Beutler Lab

Gene Symbol

Rasa3

Ensembl Gene

ENSMUSG00000031453

Gene Name

RAS p21 protein activator 3

Synonyms

GAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7100 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13566948-13677603 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13586897 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 395 (T395A)

Ref Sequence

ENSEMBL: ENSMUSP00000112998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117551]

AlphaFold

Q60790

Predicted Effect

probably benign
Transcript: ENSMUST00000117551
AA Change: T395A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: T395A

Domain	Start	End	E-Value	Type
C2	13	111	2.29e-15	SMART
C2	146	262	1.03e-17	SMART
RasGAP	275	614	3.96e-166	SMART
PH	577	679	5.53e-16	SMART
BTK	679	715	9.16e-19	SMART

Meta Mutation Damage Score

0.1195

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl10	A	G	2: 154,552,395	E89G	probably damaging	Het
Adgrv1	A	T	13: 81,270,897	V5993E	probably damaging	Het
Amdhd1	T	C	10: 93,537,074		probably null	Het
Amph	T	C	13: 19,149,841	*691Q	probably null	Het
Ankrd55	A	G	13: 112,356,110	K272E	probably benign	Het
Arhgef10l	C	T	4: 140,516,815	V838I	possibly damaging	Het
Arl2	C	A	19: 6,134,744	V160F	probably benign	Het
BC067074	T	A	13: 113,318,967	F516I		Het
Catsperb	T	C	12: 101,446,038	V128A	possibly damaging	Het
Cdk11b	T	A	4: 155,625,593	L17H	probably damaging	Het
Cpsf1	A	T	15: 76,596,114	N1391K	possibly damaging	Het
Cpxm2	C	T	7: 132,054,815	A573T	probably benign	Het
Daxx	T	C	17: 33,911,442	S144P	probably damaging	Het
Dpp3	T	C	19: 4,918,041	D303G	probably damaging	Het
Fam126b	T	A	1: 58,534,494	T384S	possibly damaging	Het
Fam181a	T	A	12: 103,315,873	N12K	probably damaging	Het
Flg2	A	T	3: 93,203,711	R1015S	unknown	Het
Fstl5	A	G	3: 76,536,293	H315R	probably benign	Het
Fut4	A	G	9: 14,751,393	S202P	probably damaging	Het
Gm5114	T	C	7: 39,408,284	D637G	possibly damaging	Het
Gstcd	G	T	3: 133,084,943	T21K	probably benign	Het
Heca	C	T	10: 17,915,373	V312M	probably benign	Het
Herpud1	A	G	8: 94,390,847	R144G	probably damaging	Het
Hrasls5	T	A	19: 7,639,558	F313I	unknown	Het
Ino80	A	G	2: 119,374,513	S1511P	possibly damaging	Het
Irf2bp2	T	C	8: 126,591,733	T365A	probably benign	Het
Klk1	G	A	7: 44,229,424	G214E	probably damaging	Het
Lama3	A	T	18: 12,582,644	N1719I	possibly damaging	Het
Lmna	A	G	3: 88,484,990	I365T	probably damaging	Het
Lrp8	C	A	4: 107,802,450	A13E	possibly damaging	Het
Ly75	A	G	2: 60,306,434	L1483P	probably benign	Het
Mid1	A	G	X: 169,985,077	D407G	probably benign	Het
Mpl	G	T	4: 118,457,410	A21E		Het
Mus81	C	T	19: 5,484,211	G360S	probably damaging	Het
Nmt2	T	A	2: 3,312,913	S250T	probably benign	Het
Nr1d1	C	A	11: 98,771,334	R158L	probably damaging	Het
Pcgf6	G	A	19: 47,050,714	P36S	unknown	Het
Pcnx2	G	A	8: 125,759,114	A1915V	probably benign	Het
Peak1	A	G	9: 56,259,393	V417A	probably damaging	Het
Phf20l1	A	G	15: 66,604,840	N262S	probably benign	Het
Ppp2r5d	A	G	17: 46,685,682	V355A	probably benign	Het
Rims1	T	A	1: 22,346,473	I432F	probably benign	Het
Rnf123	C	T	9: 108,056,639	C1080Y	probably damaging	Het
Serpina3g	T	C	12: 104,238,311		probably benign	Het
Shank2	T	A	7: 144,411,164	D836E	possibly damaging	Het
Slc24a5	A	C	2: 125,080,671	S118R	probably damaging	Het
Smg1	G	T	7: 118,184,520	H1048N	unknown	Het
Specc1l	T	G	10: 75,245,495	S242A	probably benign	Het
Tagap1	A	T	17: 6,956,712	L195Q	possibly damaging	Het
Tmem57	T	C	4: 134,806,660	D550G	probably damaging	Het
Trpc3	C	A	3: 36,650,067	E580D	probably benign	Het
Ttn	A	T	2: 76,710,822	V33940E	probably benign	Het
Upp2	G	T	2: 58,791,805	R318L	probably benign	Het
Vezt	T	A	10: 93,996,933	E205D	probably benign	Het
Vmn1r177	A	G	7: 23,866,110	F114L	probably benign	Het
Vmn2r53	C	A	7: 12,581,586	E769*	probably null	Het
Vnn3	T	C	10: 23,865,942	Y382H	probably damaging	Het

Other mutations in Rasa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Rasa3	APN	8	13595410	unclassified	probably benign
IGL02112:Rasa3	APN	8	13585042	splice site	probably benign
IGL02946:Rasa3	APN	8	13598280	missense	probably benign	0.33
IGL03085:Rasa3	APN	8	13585690	missense	probably benign	0.11
Box_canyon	UTSW	8	13584959	nonsense	probably null
Erasor	UTSW	8	13586873	critical splice donor site	probably null
koko_head	UTSW	8	13614605	missense	possibly damaging	0.70
Mount_ouray	UTSW	8	13631811	missense	possibly damaging	0.90
Poncha_pass	UTSW	8	13595373	missense	possibly damaging	0.46
Tabula	UTSW	8	13585029	missense	probably damaging	1.00
Ute	UTSW	8	13582381	splice site	probably benign
PIT4531001:Rasa3	UTSW	8	13605887	missense	probably benign	0.11
R0193:Rasa3	UTSW	8	13570233	splice site	probably null
R0710:Rasa3	UTSW	8	13583830	missense	probably damaging	1.00
R0726:Rasa3	UTSW	8	13580118	splice site	probably benign
R1405:Rasa3	UTSW	8	13588027	missense	possibly damaging	0.83
R1405:Rasa3	UTSW	8	13588027	missense	possibly damaging	0.83
R1797:Rasa3	UTSW	8	13582372	missense	probably benign	0.44
R1828:Rasa3	UTSW	8	13585035	missense	probably benign	0.02
R1895:Rasa3	UTSW	8	13631768	splice site	probably benign
R2090:Rasa3	UTSW	8	13582381	splice site	probably benign
R2374:Rasa3	UTSW	8	13577411	missense	probably damaging	1.00
R2655:Rasa3	UTSW	8	13595373	missense	possibly damaging	0.46
R3703:Rasa3	UTSW	8	13588972	missense	probably benign
R3899:Rasa3	UTSW	8	13578635	missense	probably benign	0.21
R4230:Rasa3	UTSW	8	13570264	missense	possibly damaging	0.47
R4256:Rasa3	UTSW	8	13614532	critical splice donor site	probably null
R4281:Rasa3	UTSW	8	13588946	missense	probably benign	0.01
R4498:Rasa3	UTSW	8	13614587	missense	probably benign	0.01
R4558:Rasa3	UTSW	8	13598259	missense	probably damaging	0.96
R4559:Rasa3	UTSW	8	13598259	missense	probably damaging	0.96
R4647:Rasa3	UTSW	8	13588865	missense	probably null	0.00
R4702:Rasa3	UTSW	8	13570394	missense	probably benign	0.09
R4772:Rasa3	UTSW	8	13598289	missense	probably damaging	1.00
R4774:Rasa3	UTSW	8	13577501	missense	probably benign	0.07
R4807:Rasa3	UTSW	8	13614633	missense	probably damaging	1.00
R5008:Rasa3	UTSW	8	13584959	nonsense	probably null
R5043:Rasa3	UTSW	8	13570368	missense	possibly damaging	0.59
R5352:Rasa3	UTSW	8	13631778	missense	possibly damaging	0.88
R5435:Rasa3	UTSW	8	13631811	missense	possibly damaging	0.90
R6207:Rasa3	UTSW	8	13598251	missense	possibly damaging	0.67
R6733:Rasa3	UTSW	8	13580037	missense	possibly damaging	0.88
R6855:Rasa3	UTSW	8	13585029	missense	probably damaging	1.00
R7024:Rasa3	UTSW	8	13631826	missense	probably benign	0.29
R7322:Rasa3	UTSW	8	13595857	missense	possibly damaging	0.46
R7394:Rasa3	UTSW	8	13595353	missense	probably benign	0.03
R7478:Rasa3	UTSW	8	13614605	missense	possibly damaging	0.70
R7486:Rasa3	UTSW	8	13590201	critical splice donor site	probably null
R7554:Rasa3	UTSW	8	13595390	missense	probably damaging	0.99
R7575:Rasa3	UTSW	8	13595887	missense	possibly damaging	0.73
R7641:Rasa3	UTSW	8	13584961	missense	probably benign	0.11
R7667:Rasa3	UTSW	8	13588015	missense	probably benign	0.27
R7751:Rasa3	UTSW	8	13568708	missense	probably benign	0.18
R7999:Rasa3	UTSW	8	13631805	missense	probably benign	0.04
R8039:Rasa3	UTSW	8	13588931	missense	probably damaging	1.00
R8125:Rasa3	UTSW	8	13577801	splice site	probably null
R8514:Rasa3	UTSW	8	13581322	missense	probably benign	0.02
R8726:Rasa3	UTSW	8	13576381	missense	probably benign	0.00
R8728:Rasa3	UTSW	8	13586873	critical splice donor site	probably null
R8790:Rasa3	UTSW	8	13677391	critical splice donor site	probably null
R9036:Rasa3	UTSW	8	13595851	missense	probably benign	0.06
R9483:Rasa3	UTSW	8	13580033	critical splice donor site	probably null
R9602:Rasa3	UTSW	8	13631844	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGGAGTTTGGATATAAAAGACACTATG -3'
(R):5'- GCATCCATGACCCACTCAGTG -3'

Sequencing Primer
(F):5'- TCCTATCATCATCTGTCAATCATCTC -3'
(R):5'- GGCCCCACTCAGGAGACTTTG -3'

Posted On

2019-05-15