Incidental Mutation 'R7100:Rasa3'
ID 550766
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene Name RAS p21 protein activator 3
Synonyms GAPIII activator 3, Ras GTPase-activating protein III, scat, hlb381, GAPIII, R-Ras gap
MMRRC Submission 045192-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7100 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 13617218-13727590 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13636897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 395 (T395A)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551]
AlphaFold Q60790
Predicted Effect probably benign
Transcript: ENSMUST00000117551
AA Change: T395A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: T395A

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Meta Mutation Damage Score 0.1195 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,394,315 (GRCm39) E89G probably damaging Het
Adgrv1 A T 13: 81,419,016 (GRCm39) V5993E probably damaging Het
Amdhd1 T C 10: 93,372,936 (GRCm39) probably null Het
Amph T C 13: 19,334,011 (GRCm39) *691Q probably null Het
Ankrd55 A G 13: 112,492,644 (GRCm39) K272E probably benign Het
Arhgef10l C T 4: 140,244,126 (GRCm39) V838I possibly damaging Het
Arl2 C A 19: 6,184,774 (GRCm39) V160F probably benign Het
Catsperb T C 12: 101,412,297 (GRCm39) V128A possibly damaging Het
Cdk11b T A 4: 155,710,050 (GRCm39) L17H probably damaging Het
Cpsf1 A T 15: 76,480,314 (GRCm39) N1391K possibly damaging Het
Cpxm2 C T 7: 131,656,544 (GRCm39) A573T probably benign Het
Cspg4b T A 13: 113,455,501 (GRCm39) F516I Het
Daxx T C 17: 34,130,416 (GRCm39) S144P probably damaging Het
Dpp3 T C 19: 4,968,069 (GRCm39) D303G probably damaging Het
Fam181a T A 12: 103,282,132 (GRCm39) N12K probably damaging Het
Flg2 A T 3: 93,111,018 (GRCm39) R1015S unknown Het
Fstl5 A G 3: 76,443,600 (GRCm39) H315R probably benign Het
Fut4 A G 9: 14,662,689 (GRCm39) S202P probably damaging Het
Gm5114 T C 7: 39,057,708 (GRCm39) D637G possibly damaging Het
Gstcd G T 3: 132,790,704 (GRCm39) T21K probably benign Het
Heca C T 10: 17,791,121 (GRCm39) V312M probably benign Het
Herpud1 A G 8: 95,117,475 (GRCm39) R144G probably damaging Het
Hycc2 T A 1: 58,573,653 (GRCm39) T384S possibly damaging Het
Ino80 A G 2: 119,204,994 (GRCm39) S1511P possibly damaging Het
Irf2bp2 T C 8: 127,318,472 (GRCm39) T365A probably benign Het
Klk1 G A 7: 43,878,848 (GRCm39) G214E probably damaging Het
Lama3 A T 18: 12,715,701 (GRCm39) N1719I possibly damaging Het
Lmna A G 3: 88,392,297 (GRCm39) I365T probably damaging Het
Lrp8 C A 4: 107,659,647 (GRCm39) A13E possibly damaging Het
Ly75 A G 2: 60,136,778 (GRCm39) L1483P probably benign Het
Maco1 T C 4: 134,533,971 (GRCm39) D550G probably damaging Het
Mid1 A G X: 168,768,073 (GRCm39) D407G probably benign Het
Mpl G T 4: 118,314,607 (GRCm39) A21E Het
Mus81 C T 19: 5,534,239 (GRCm39) G360S probably damaging Het
Nmt2 T A 2: 3,313,950 (GRCm39) S250T probably benign Het
Nr1d1 C A 11: 98,662,160 (GRCm39) R158L probably damaging Het
Pcgf6 G A 19: 47,039,153 (GRCm39) P36S unknown Het
Pcnx2 G A 8: 126,485,853 (GRCm39) A1915V probably benign Het
Peak1 A G 9: 56,166,677 (GRCm39) V417A probably damaging Het
Phf20l1 A G 15: 66,476,689 (GRCm39) N262S probably benign Het
Plaat5 T A 19: 7,616,923 (GRCm39) F313I unknown Het
Ppp2r5d A G 17: 46,996,608 (GRCm39) V355A probably benign Het
Rims1 T A 1: 22,416,697 (GRCm39) I432F probably benign Het
Rnf123 C T 9: 107,933,838 (GRCm39) C1080Y probably damaging Het
Serpina3g T C 12: 104,204,570 (GRCm39) probably benign Het
Shank2 T A 7: 143,964,901 (GRCm39) D836E possibly damaging Het
Slc24a5 A C 2: 124,922,591 (GRCm39) S118R probably damaging Het
Smg1 G T 7: 117,783,743 (GRCm39) H1048N unknown Het
Specc1l T G 10: 75,081,329 (GRCm39) S242A probably benign Het
Tagap1 A T 17: 7,224,111 (GRCm39) L195Q possibly damaging Het
Trpc3 C A 3: 36,704,216 (GRCm39) E580D probably benign Het
Ttn A T 2: 76,541,166 (GRCm39) V33940E probably benign Het
Upp2 G T 2: 58,681,817 (GRCm39) R318L probably benign Het
Vezt T A 10: 93,832,795 (GRCm39) E205D probably benign Het
Vmn1r177 A G 7: 23,565,535 (GRCm39) F114L probably benign Het
Vmn2r53 C A 7: 12,315,513 (GRCm39) E769* probably null Het
Vnn3 T C 10: 23,741,840 (GRCm39) Y382H probably damaging Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13,645,410 (GRCm39) unclassified probably benign
IGL02112:Rasa3 APN 8 13,635,042 (GRCm39) splice site probably benign
IGL02946:Rasa3 APN 8 13,648,280 (GRCm39) missense probably benign 0.33
IGL03085:Rasa3 APN 8 13,635,690 (GRCm39) missense probably benign 0.11
Box_canyon UTSW 8 13,634,959 (GRCm39) nonsense probably null
Erasor UTSW 8 13,636,873 (GRCm39) critical splice donor site probably null
koko_head UTSW 8 13,664,605 (GRCm39) missense possibly damaging 0.70
Mount_ouray UTSW 8 13,681,811 (GRCm39) missense possibly damaging 0.90
Poncha_pass UTSW 8 13,645,373 (GRCm39) missense possibly damaging 0.46
Tabula UTSW 8 13,635,029 (GRCm39) missense probably damaging 1.00
Ute UTSW 8 13,632,381 (GRCm39) splice site probably benign
PIT4531001:Rasa3 UTSW 8 13,655,887 (GRCm39) missense probably benign 0.11
R0193:Rasa3 UTSW 8 13,620,233 (GRCm39) splice site probably null
R0710:Rasa3 UTSW 8 13,633,830 (GRCm39) missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13,630,118 (GRCm39) splice site probably benign
R1405:Rasa3 UTSW 8 13,638,027 (GRCm39) missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13,638,027 (GRCm39) missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13,632,372 (GRCm39) missense probably benign 0.44
R1828:Rasa3 UTSW 8 13,635,035 (GRCm39) missense probably benign 0.02
R1895:Rasa3 UTSW 8 13,681,768 (GRCm39) splice site probably benign
R2090:Rasa3 UTSW 8 13,632,381 (GRCm39) splice site probably benign
R2374:Rasa3 UTSW 8 13,627,411 (GRCm39) missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13,645,373 (GRCm39) missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13,638,972 (GRCm39) missense probably benign
R3899:Rasa3 UTSW 8 13,628,635 (GRCm39) missense probably benign 0.21
R4230:Rasa3 UTSW 8 13,620,264 (GRCm39) missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13,664,532 (GRCm39) critical splice donor site probably null
R4281:Rasa3 UTSW 8 13,638,946 (GRCm39) missense probably benign 0.01
R4498:Rasa3 UTSW 8 13,664,587 (GRCm39) missense probably benign 0.01
R4558:Rasa3 UTSW 8 13,648,259 (GRCm39) missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13,648,259 (GRCm39) missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13,638,865 (GRCm39) missense probably null 0.00
R4702:Rasa3 UTSW 8 13,620,394 (GRCm39) missense probably benign 0.09
R4772:Rasa3 UTSW 8 13,648,289 (GRCm39) missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13,627,501 (GRCm39) missense probably benign 0.07
R4807:Rasa3 UTSW 8 13,664,633 (GRCm39) missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13,634,959 (GRCm39) nonsense probably null
R5043:Rasa3 UTSW 8 13,620,368 (GRCm39) missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13,681,778 (GRCm39) missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13,681,811 (GRCm39) missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13,648,251 (GRCm39) missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13,630,037 (GRCm39) missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13,635,029 (GRCm39) missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13,681,826 (GRCm39) missense probably benign 0.29
R7322:Rasa3 UTSW 8 13,645,857 (GRCm39) missense possibly damaging 0.46
R7394:Rasa3 UTSW 8 13,645,353 (GRCm39) missense probably benign 0.03
R7478:Rasa3 UTSW 8 13,664,605 (GRCm39) missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13,640,201 (GRCm39) critical splice donor site probably null
R7554:Rasa3 UTSW 8 13,645,390 (GRCm39) missense probably damaging 0.99
R7575:Rasa3 UTSW 8 13,645,887 (GRCm39) missense possibly damaging 0.73
R7641:Rasa3 UTSW 8 13,634,961 (GRCm39) missense probably benign 0.11
R7667:Rasa3 UTSW 8 13,638,015 (GRCm39) missense probably benign 0.27
R7751:Rasa3 UTSW 8 13,618,708 (GRCm39) missense probably benign 0.18
R7999:Rasa3 UTSW 8 13,681,805 (GRCm39) missense probably benign 0.04
R8039:Rasa3 UTSW 8 13,638,931 (GRCm39) missense probably damaging 1.00
R8125:Rasa3 UTSW 8 13,627,801 (GRCm39) splice site probably null
R8514:Rasa3 UTSW 8 13,631,322 (GRCm39) missense probably benign 0.02
R8726:Rasa3 UTSW 8 13,626,381 (GRCm39) missense probably benign 0.00
R8728:Rasa3 UTSW 8 13,636,873 (GRCm39) critical splice donor site probably null
R8790:Rasa3 UTSW 8 13,727,391 (GRCm39) critical splice donor site probably null
R9036:Rasa3 UTSW 8 13,645,851 (GRCm39) missense probably benign 0.06
R9483:Rasa3 UTSW 8 13,630,033 (GRCm39) critical splice donor site probably null
R9602:Rasa3 UTSW 8 13,681,844 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGTTTGGATATAAAAGACACTATG -3'
(R):5'- GCATCCATGACCCACTCAGTG -3'

Sequencing Primer
(F):5'- TCCTATCATCATCTGTCAATCATCTC -3'
(R):5'- GGCCCCACTCAGGAGACTTTG -3'
Posted On 2019-05-15