Incidental Mutation 'R7100:Herpud1'
ID550767
Institutional Source Beutler Lab
Gene Symbol Herpud1
Ensembl Gene ENSMUSG00000031770
Gene Namehomocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
SynonymsHerp, Mifl
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R7100 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94386438-94395377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94390847 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 144 (R144G)
Ref Sequence ENSEMBL: ENSMUSP00000124201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034220
AA Change: R143G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770
AA Change: R143G

DomainStartEndE-ValueType
UBQ 10 86 1.99e-13 SMART
low complexity region 216 242 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159450
Predicted Effect probably benign
Transcript: ENSMUST00000161085
Predicted Effect probably damaging
Transcript: ENSMUST00000161576
AA Change: R144G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770
AA Change: R144G

DomainStartEndE-ValueType
UBQ 10 87 7.55e-14 SMART
low complexity region 217 243 N/A INTRINSIC
low complexity region 274 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211982
AA Change: R20G

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,552,395 E89G probably damaging Het
Adgrv1 A T 13: 81,270,897 V5993E probably damaging Het
Amdhd1 T C 10: 93,537,074 probably null Het
Amph T C 13: 19,149,841 *691Q probably null Het
Ankrd55 A G 13: 112,356,110 K272E probably benign Het
Arhgef10l C T 4: 140,516,815 V838I possibly damaging Het
Arl2 C A 19: 6,134,744 V160F probably benign Het
BC067074 T A 13: 113,318,967 F516I Het
Catsperb T C 12: 101,446,038 V128A possibly damaging Het
Cdk11b T A 4: 155,625,593 L17H probably damaging Het
Cpsf1 A T 15: 76,596,114 N1391K possibly damaging Het
Cpxm2 C T 7: 132,054,815 A573T probably benign Het
Daxx T C 17: 33,911,442 S144P probably damaging Het
Dpp3 T C 19: 4,918,041 D303G probably damaging Het
Fam126b T A 1: 58,534,494 T384S possibly damaging Het
Fam181a T A 12: 103,315,873 N12K probably damaging Het
Flg2 A T 3: 93,203,711 R1015S unknown Het
Fstl5 A G 3: 76,536,293 H315R probably benign Het
Fut4 A G 9: 14,751,393 S202P probably damaging Het
Gm5114 T C 7: 39,408,284 D637G possibly damaging Het
Gstcd G T 3: 133,084,943 T21K probably benign Het
Heca C T 10: 17,915,373 V312M probably benign Het
Hrasls5 T A 19: 7,639,558 F313I unknown Het
Ino80 A G 2: 119,374,513 S1511P possibly damaging Het
Irf2bp2 T C 8: 126,591,733 T365A probably benign Het
Klk1 G A 7: 44,229,424 G214E probably damaging Het
Lama3 A T 18: 12,582,644 N1719I possibly damaging Het
Lmna A G 3: 88,484,990 I365T probably damaging Het
Lrp8 C A 4: 107,802,450 A13E possibly damaging Het
Ly75 A G 2: 60,306,434 L1483P probably benign Het
Mid1 A G X: 169,985,077 D407G probably benign Het
Mpl G T 4: 118,457,410 A21E Het
Mus81 C T 19: 5,484,211 G360S probably damaging Het
Nmt2 T A 2: 3,312,913 S250T probably benign Het
Nr1d1 C A 11: 98,771,334 R158L probably damaging Het
Pcgf6 G A 19: 47,050,714 P36S unknown Het
Pcnx2 G A 8: 125,759,114 A1915V probably benign Het
Peak1 A G 9: 56,259,393 V417A probably damaging Het
Phf20l1 A G 15: 66,604,840 N262S probably benign Het
Ppp2r5d A G 17: 46,685,682 V355A probably benign Het
Rasa3 T C 8: 13,586,897 T395A probably benign Het
Rims1 T A 1: 22,346,473 I432F probably benign Het
Rnf123 C T 9: 108,056,639 C1080Y probably damaging Het
Serpina3g T C 12: 104,238,311 probably benign Het
Shank2 T A 7: 144,411,164 D836E possibly damaging Het
Slc24a5 A C 2: 125,080,671 S118R probably damaging Het
Smg1 G T 7: 118,184,520 H1048N unknown Het
Specc1l T G 10: 75,245,495 S242A probably benign Het
Tagap1 A T 17: 6,956,712 L195Q possibly damaging Het
Tmem57 T C 4: 134,806,660 D550G probably damaging Het
Trpc3 C A 3: 36,650,067 E580D probably benign Het
Ttn A T 2: 76,710,822 V33940E probably benign Het
Upp2 G T 2: 58,791,805 R318L probably benign Het
Vezt T A 10: 93,996,933 E205D probably benign Het
Vmn1r177 A G 7: 23,866,110 F114L probably benign Het
Vmn2r53 C A 7: 12,581,586 E769* probably null Het
Vnn3 T C 10: 23,865,942 Y382H probably damaging Het
Other mutations in Herpud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Herpud1 APN 8 94394642 nonsense probably null
R1667:Herpud1 UTSW 8 94389366 missense probably damaging 1.00
R2015:Herpud1 UTSW 8 94392206 missense probably benign 0.44
R2255:Herpud1 UTSW 8 94394613 missense probably benign 0.06
R3707:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R4940:Herpud1 UTSW 8 94390842 missense probably benign 0.18
R4961:Herpud1 UTSW 8 94390826 missense probably benign 0.00
R4981:Herpud1 UTSW 8 94391794 missense probably damaging 1.00
R5214:Herpud1 UTSW 8 94390851 splice site probably null
R5499:Herpud1 UTSW 8 94389413 missense probably damaging 1.00
R5835:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R5985:Herpud1 UTSW 8 94390794 missense probably damaging 1.00
R6702:Herpud1 UTSW 8 94392526 critical splice donor site probably null
R6794:Herpud1 UTSW 8 94394770 intron probably null
R7060:Herpud1 UTSW 8 94390763 missense probably benign 0.04
R7328:Herpud1 UTSW 8 94386620 missense possibly damaging 0.76
R7384:Herpud1 UTSW 8 94389377 missense probably damaging 0.98
R7898:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R7981:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R8025:Herpud1 UTSW 8 94392521 missense probably damaging 1.00
R8036:Herpud1 UTSW 8 94392386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGGCCCTTTGTTCTGAC -3'
(R):5'- AAGGGGCTGTGTACTTTCGC -3'

Sequencing Primer
(F):5'- CAGGCCCTTTGTTCTGACGTTTATG -3'
(R):5'- GCTGTCCTGGAACTCGATCTG -3'
Posted On2019-05-15