Mutagenetix > Incidental Mutation

Incidental Mutation 'R7100:Specc1l'

550775

Institutional Source

Beutler Lab

Gene Symbol

Specc1l

Ensembl Gene

ENSMUSG00000033444

Gene Name

sperm antigen with calponin homology and coiled-coil domains 1-like

Synonyms

Cytsa, Specc1l

MMRRC Submission

045192-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.599) question?

Stock #

R7100 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75212073-75312743 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 75245495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 242 (S242A)

Ref Sequence

ENSEMBL: ENSMUSP00000151322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766] [ENSMUST00000219387]

AlphaFold

Q2KN98

Predicted Effect

probably benign
Transcript: ENSMUST00000040105
AA Change: S259A

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: S259A

Domain	Start	End	E-Value	Type
low complexity region	97	107	N/A	INTRINSIC
low complexity region	135	149	N/A	INTRINSIC
coiled coil region	255	298	N/A	INTRINSIC
low complexity region	376	390	N/A	INTRINSIC
coiled coil region	412	467	N/A	INTRINSIC
coiled coil region	505	825	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	989	1010	N/A	INTRINSIC
CH	1031	1129	1.52e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105421
AA Change: S259A

PolyPhen 2 Score 0.308 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: S259A

Domain	Start	End	E-Value	Type
low complexity region	80	90	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
coiled coil region	238	281	N/A	INTRINSIC
low complexity region	359	373	N/A	INTRINSIC
coiled coil region	395	450	N/A	INTRINSIC
coiled coil region	488	808	N/A	INTRINSIC
low complexity region	829	841	N/A	INTRINSIC
low complexity region	972	993	N/A	INTRINSIC
CH	1014	1112	1.52e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218766
AA Change: S242A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000219387

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl10	A	G	2: 154,552,395	E89G	probably damaging	Het
Adgrv1	A	T	13: 81,270,897	V5993E	probably damaging	Het
Amdhd1	T	C	10: 93,537,074		probably null	Het
Amph	T	C	13: 19,149,841	*691Q	probably null	Het
Ankrd55	A	G	13: 112,356,110	K272E	probably benign	Het
Arhgef10l	C	T	4: 140,516,815	V838I	possibly damaging	Het
Arl2	C	A	19: 6,134,744	V160F	probably benign	Het
BC067074	T	A	13: 113,318,967	F516I		Het
Catsperb	T	C	12: 101,446,038	V128A	possibly damaging	Het
Cdk11b	T	A	4: 155,625,593	L17H	probably damaging	Het
Cpsf1	A	T	15: 76,596,114	N1391K	possibly damaging	Het
Cpxm2	C	T	7: 132,054,815	A573T	probably benign	Het
Daxx	T	C	17: 33,911,442	S144P	probably damaging	Het
Dpp3	T	C	19: 4,918,041	D303G	probably damaging	Het
Fam126b	T	A	1: 58,534,494	T384S	possibly damaging	Het
Fam181a	T	A	12: 103,315,873	N12K	probably damaging	Het
Flg2	A	T	3: 93,203,711	R1015S	unknown	Het
Fstl5	A	G	3: 76,536,293	H315R	probably benign	Het
Fut4	A	G	9: 14,751,393	S202P	probably damaging	Het
Gm5114	T	C	7: 39,408,284	D637G	possibly damaging	Het
Gstcd	G	T	3: 133,084,943	T21K	probably benign	Het
Heca	C	T	10: 17,915,373	V312M	probably benign	Het
Herpud1	A	G	8: 94,390,847	R144G	probably damaging	Het
Hrasls5	T	A	19: 7,639,558	F313I	unknown	Het
Ino80	A	G	2: 119,374,513	S1511P	possibly damaging	Het
Irf2bp2	T	C	8: 126,591,733	T365A	probably benign	Het
Klk1	G	A	7: 44,229,424	G214E	probably damaging	Het
Lama3	A	T	18: 12,582,644	N1719I	possibly damaging	Het
Lmna	A	G	3: 88,484,990	I365T	probably damaging	Het
Lrp8	C	A	4: 107,802,450	A13E	possibly damaging	Het
Ly75	A	G	2: 60,306,434	L1483P	probably benign	Het
Mid1	A	G	X: 169,985,077	D407G	probably benign	Het
Mpl	G	T	4: 118,457,410	A21E		Het
Mus81	C	T	19: 5,484,211	G360S	probably damaging	Het
Nmt2	T	A	2: 3,312,913	S250T	probably benign	Het
Nr1d1	C	A	11: 98,771,334	R158L	probably damaging	Het
Pcgf6	G	A	19: 47,050,714	P36S	unknown	Het
Pcnx2	G	A	8: 125,759,114	A1915V	probably benign	Het
Peak1	A	G	9: 56,259,393	V417A	probably damaging	Het
Phf20l1	A	G	15: 66,604,840	N262S	probably benign	Het
Ppp2r5d	A	G	17: 46,685,682	V355A	probably benign	Het
Rasa3	T	C	8: 13,586,897	T395A	probably benign	Het
Rims1	T	A	1: 22,346,473	I432F	probably benign	Het
Rnf123	C	T	9: 108,056,639	C1080Y	probably damaging	Het
Serpina3g	T	C	12: 104,238,311		probably benign	Het
Shank2	T	A	7: 144,411,164	D836E	possibly damaging	Het
Slc24a5	A	C	2: 125,080,671	S118R	probably damaging	Het
Smg1	G	T	7: 118,184,520	H1048N	unknown	Het
Tagap1	A	T	17: 6,956,712	L195Q	possibly damaging	Het
Tmem57	T	C	4: 134,806,660	D550G	probably damaging	Het
Trpc3	C	A	3: 36,650,067	E580D	probably benign	Het
Ttn	A	T	2: 76,710,822	V33940E	probably benign	Het
Upp2	G	T	2: 58,791,805	R318L	probably benign	Het
Vezt	T	A	10: 93,996,933	E205D	probably benign	Het
Vmn1r177	A	G	7: 23,866,110	F114L	probably benign	Het
Vmn2r53	C	A	7: 12,581,586	E769*	probably null	Het
Vnn3	T	C	10: 23,865,942	Y382H	probably damaging	Het

Other mutations in Specc1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00549:Specc1l	APN	10	75246221	missense	probably benign	0.12
IGL01638:Specc1l	APN	10	75246205	nonsense	probably null
IGL01970:Specc1l	APN	10	75245761	missense	probably damaging	1.00
IGL02539:Specc1l	APN	10	75267508	missense	probably benign	0.39
IGL02737:Specc1l	APN	10	75246324	missense	probably damaging	0.99
IGL02941:Specc1l	APN	10	75241188	missense	probably benign	0.10
R0305:Specc1l	UTSW	10	75245829	missense	probably damaging	1.00
R0374:Specc1l	UTSW	10	75248459	missense	probably damaging	0.99
R0402:Specc1l	UTSW	10	75246426	missense	probably damaging	1.00
R1456:Specc1l	UTSW	10	75246284	missense	probably damaging	0.98
R1508:Specc1l	UTSW	10	75307238	missense	probably benign	0.00
R1861:Specc1l	UTSW	10	75309859	missense	probably damaging	1.00
R1869:Specc1l	UTSW	10	75261825	missense	probably damaging	1.00
R1929:Specc1l	UTSW	10	75245604	missense	probably damaging	1.00
R1930:Specc1l	UTSW	10	75309824	missense	probably damaging	1.00
R2021:Specc1l	UTSW	10	75267591	critical splice donor site	probably null
R2209:Specc1l	UTSW	10	75246576	missense	probably damaging	1.00
R2271:Specc1l	UTSW	10	75245604	missense	probably damaging	1.00
R2937:Specc1l	UTSW	10	75259131	missense	probably damaging	0.98
R4415:Specc1l	UTSW	10	75246328	missense	possibly damaging	0.92
R4758:Specc1l	UTSW	10	75246348	missense	probably damaging	0.99
R5344:Specc1l	UTSW	10	75246173	missense	possibly damaging	0.84
R5383:Specc1l	UTSW	10	75246705	missense	possibly damaging	0.86
R5426:Specc1l	UTSW	10	75267550	missense	probably benign	0.21
R5774:Specc1l	UTSW	10	75245400	missense	probably damaging	1.00
R5788:Specc1l	UTSW	10	75276921	missense	probably damaging	1.00
R6101:Specc1l	UTSW	10	75248632	missense	probably damaging	1.00
R6105:Specc1l	UTSW	10	75248632	missense	probably damaging	1.00
R6136:Specc1l	UTSW	10	75246660	missense	probably benign	0.38
R6345:Specc1l	UTSW	10	75248488	missense	probably damaging	0.99
R6459:Specc1l	UTSW	10	75246167	missense	probably damaging	1.00
R6641:Specc1l	UTSW	10	75246549	missense	probably damaging	1.00
R6996:Specc1l	UTSW	10	75246279	missense	probably benign	0.23
R7475:Specc1l	UTSW	10	75246447	missense	possibly damaging	0.59
R7545:Specc1l	UTSW	10	75245087	missense	probably benign	0.00
R7615:Specc1l	UTSW	10	75263286	missense	probably benign	0.02
R7635:Specc1l	UTSW	10	75276804	missense	probably damaging	1.00
R7640:Specc1l	UTSW	10	75257869	missense	probably damaging	1.00
R7682:Specc1l	UTSW	10	75245802	missense	probably damaging	0.99
R7711:Specc1l	UTSW	10	75230808	missense	probably benign	0.02
R7742:Specc1l	UTSW	10	75246417	missense	probably benign	0.01
R7847:Specc1l	UTSW	10	75309836	missense	probably damaging	0.99
R8015:Specc1l	UTSW	10	75241068	missense	probably benign	0.17
R8030:Specc1l	UTSW	10	75248555	missense	probably damaging	1.00
R8882:Specc1l	UTSW	10	75229855	start codon destroyed	unknown
R9069:Specc1l	UTSW	10	75230806	missense	probably benign	0.03
R9790:Specc1l	UTSW	10	75230769	missense	probably benign	0.21
R9791:Specc1l	UTSW	10	75230769	missense	probably benign	0.21
X0021:Specc1l	UTSW	10	75274040	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCCAAGGTGAAAGATCTCCTC -3'
(R):5'- TACCGAAGATGTCAGAGTTCCTC -3'

Sequencing Primer
(F):5'- GGTGAAAGATCTCCTCACACTGG -3'
(R):5'- GAAGATGTCAGAGTTCCTCCTCCG -3'

Posted On

2019-05-15