Mutagenetix > Incidental Mutations

Incidental Mutation 'R0595:Brca1'

55078

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

038785-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0595 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101524887 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 807 (V807A)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: V807A

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: V807A

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188168

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,740,417	D1093E	probably damaging	Het
Aldh2	G	T	5: 121,573,500	A276D	probably damaging	Het
Aldh2	C	T	5: 121,573,501	A276T	probably damaging	Het
Aldh7a1	C	T	18: 56,546,893		probably benign	Het
Ano1	C	T	7: 144,590,153	R964H	possibly damaging	Het
Apob	G	A	12: 8,008,369	V2251I	probably benign	Het
Atp6v1e1	A	G	6: 120,801,130	V148A	probably benign	Het
Bbs9	T	A	9: 22,496,815	H73Q	probably benign	Het
Cacna1b	C	T	2: 24,649,989		probably benign	Het
Cadps2	A	T	6: 23,321,704		probably null	Het
Cep152	T	C	2: 125,595,063	Q519R	probably damaging	Het
Cep295	A	C	9: 15,332,191	Y1608*	probably null	Het
Cfap54	T	C	10: 92,884,736	I2619V	unknown	Het
Dnajb9	A	G	12: 44,208,284	V7A	probably benign	Het
Ep400	T	C	5: 110,703,542	K1358R	unknown	Het
Fbxw7	C	A	3: 84,977,367		probably null	Het
Fsip2	T	C	2: 82,946,952	Y108H	probably damaging	Het
Ggt6	T	A	11: 72,437,667	L331Q	probably damaging	Het
Ifitm1	T	A	7: 140,968,329	I25N	possibly damaging	Het
Krt75	C	T	15: 101,568,354	E367K	probably damaging	Het
Lifr	A	G	15: 7,177,469	Y487C	probably damaging	Het
Map3k6	G	T	4: 133,241,263	G59W	probably damaging	Het
Mme	A	G	3: 63,328,181	T129A	probably benign	Het
Mmp10	G	A	9: 7,508,198	E442K	probably benign	Het
Myh13	T	C	11: 67,344,846	S646P	probably benign	Het
Nbea	A	T	3: 55,628,496	I2889N	probably benign	Het
Nlrp4d	T	A	7: 10,381,045	K581N	probably benign	Het
Nr3c2	C	T	8: 76,909,604	P445S	possibly damaging	Het
Olfr487	A	T	7: 108,211,661	N289K	probably damaging	Het
Pck1	T	A	2: 173,157,029	V360E	probably damaging	Het
Plekha7	T	C	7: 116,144,968	D766G	probably damaging	Het
Prag1	A	G	8: 36,147,002	N1236S	probably damaging	Het
Prkdc	A	C	16: 15,808,088	Q3326P	probably damaging	Het
Prrc2b	T	C	2: 32,183,177	M57T	probably damaging	Het
Rb1	A	T	14: 73,273,680	F330I	probably damaging	Het
Rufy4	A	G	1: 74,140,930	E448G	possibly damaging	Het
Scn10a	T	A	9: 119,666,063	M371L	probably benign	Het
Sgta	T	C	10: 81,048,908	D189G	probably damaging	Het
Spata31d1b	A	G	13: 59,716,277	H413R	probably benign	Het
Stau2	T	C	1: 16,440,450	T95A	probably damaging	Het
Supt4a	C	T	11: 87,743,156		probably null	Het
Tanc2	A	G	11: 105,714,177		probably null	Het
Tap2	T	A	17: 34,212,354	V422D	probably damaging	Het
Tas2r138	A	G	6: 40,612,865	L149P	probably damaging	Het
Tex15	T	C	8: 33,572,617	S692P	probably damaging	Het
Tgm2	C	T	2: 158,143,042	R48H	probably damaging	Het
Ticrr	T	A	7: 79,695,563	F1725L	possibly damaging	Het
Tnpo2	T	A	8: 85,052,041	C672*	probably null	Het
Xkr9	A	G	1: 13,700,784	I175V	probably benign	Het
Zfp428	T	A	7: 24,515,378	S140T	probably benign	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7944:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGAGTGAGCACAGTCCTTTTGGGG -3'
(R):5'- ACGCCAAATGTCTGACAGTGCC -3'

Sequencing Primer
(F):5'- CCTTTTGGGGACTTCTAGGTTTTG -3'
(R):5'- TGTCTGACAGTGCCAAAGAAC -3'

Posted On

2013-07-11