Mutagenetix > Incidental Mutation

Incidental Mutation 'R7100:Amph'

550781

Institutional Source

Beutler Lab

Gene Symbol

Amph

Ensembl Gene

ENSMUSG00000021314

Gene Name

amphiphysin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R7100 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18948205-19150921 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 19149841 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 691 (*691Q)

Ref Sequence

ENSEMBL: ENSMUSP00000142766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]

AlphaFold

Q7TQF7

Predicted Effect

probably null
Transcript: ENSMUST00000003345
AA Change: *687Q

SMART Domains

Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: *687Q

Domain	Start	End	E-Value	Type
BAR	12	233	8.47e-80	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	424	445	N/A	INTRINSIC
low complexity region	479	499	N/A	INTRINSIC
SH3	616	686	7.82e-10	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000200466
AA Change: *691Q

SMART Domains

Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: *691Q

Domain	Start	End	E-Value	Type
BAR	12	233	2.3e-82	SMART
low complexity region	260	277	N/A	INTRINSIC
low complexity region	282	295	N/A	INTRINSIC
low complexity region	301	315	N/A	INTRINSIC
low complexity region	341	362	N/A	INTRINSIC
low complexity region	428	449	N/A	INTRINSIC
low complexity region	483	503	N/A	INTRINSIC
SH3	620	690	4.9e-12	SMART

Meta Mutation Damage Score

0.8589

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl10	A	G	2: 154,552,395	E89G	probably damaging	Het
Adgrv1	A	T	13: 81,270,897	V5993E	probably damaging	Het
Amdhd1	T	C	10: 93,537,074		probably null	Het
Ankrd55	A	G	13: 112,356,110	K272E	probably benign	Het
Arhgef10l	C	T	4: 140,516,815	V838I	possibly damaging	Het
Arl2	C	A	19: 6,134,744	V160F	probably benign	Het
BC067074	T	A	13: 113,318,967	F516I		Het
Catsperb	T	C	12: 101,446,038	V128A	possibly damaging	Het
Cdk11b	T	A	4: 155,625,593	L17H	probably damaging	Het
Cpsf1	A	T	15: 76,596,114	N1391K	possibly damaging	Het
Cpxm2	C	T	7: 132,054,815	A573T	probably benign	Het
Daxx	T	C	17: 33,911,442	S144P	probably damaging	Het
Dpp3	T	C	19: 4,918,041	D303G	probably damaging	Het
Fam126b	T	A	1: 58,534,494	T384S	possibly damaging	Het
Fam181a	T	A	12: 103,315,873	N12K	probably damaging	Het
Flg2	A	T	3: 93,203,711	R1015S	unknown	Het
Fstl5	A	G	3: 76,536,293	H315R	probably benign	Het
Fut4	A	G	9: 14,751,393	S202P	probably damaging	Het
Gm5114	T	C	7: 39,408,284	D637G	possibly damaging	Het
Gstcd	G	T	3: 133,084,943	T21K	probably benign	Het
Heca	C	T	10: 17,915,373	V312M	probably benign	Het
Herpud1	A	G	8: 94,390,847	R144G	probably damaging	Het
Hrasls5	T	A	19: 7,639,558	F313I	unknown	Het
Ino80	A	G	2: 119,374,513	S1511P	possibly damaging	Het
Irf2bp2	T	C	8: 126,591,733	T365A	probably benign	Het
Klk1	G	A	7: 44,229,424	G214E	probably damaging	Het
Lama3	A	T	18: 12,582,644	N1719I	possibly damaging	Het
Lmna	A	G	3: 88,484,990	I365T	probably damaging	Het
Lrp8	C	A	4: 107,802,450	A13E	possibly damaging	Het
Ly75	A	G	2: 60,306,434	L1483P	probably benign	Het
Mid1	A	G	X: 169,985,077	D407G	probably benign	Het
Mpl	G	T	4: 118,457,410	A21E		Het
Mus81	C	T	19: 5,484,211	G360S	probably damaging	Het
Nmt2	T	A	2: 3,312,913	S250T	probably benign	Het
Nr1d1	C	A	11: 98,771,334	R158L	probably damaging	Het
Pcgf6	G	A	19: 47,050,714	P36S	unknown	Het
Pcnx2	G	A	8: 125,759,114	A1915V	probably benign	Het
Peak1	A	G	9: 56,259,393	V417A	probably damaging	Het
Phf20l1	A	G	15: 66,604,840	N262S	probably benign	Het
Ppp2r5d	A	G	17: 46,685,682	V355A	probably benign	Het
Rasa3	T	C	8: 13,586,897	T395A	probably benign	Het
Rims1	T	A	1: 22,346,473	I432F	probably benign	Het
Rnf123	C	T	9: 108,056,639	C1080Y	probably damaging	Het
Serpina3g	T	C	12: 104,238,311		probably benign	Het
Shank2	T	A	7: 144,411,164	D836E	possibly damaging	Het
Slc24a5	A	C	2: 125,080,671	S118R	probably damaging	Het
Smg1	G	T	7: 118,184,520	H1048N	unknown	Het
Specc1l	T	G	10: 75,245,495	S242A	probably benign	Het
Tagap1	A	T	17: 6,956,712	L195Q	possibly damaging	Het
Tmem57	T	C	4: 134,806,660	D550G	probably damaging	Het
Trpc3	C	A	3: 36,650,067	E580D	probably benign	Het
Ttn	A	T	2: 76,710,822	V33940E	probably benign	Het
Upp2	G	T	2: 58,791,805	R318L	probably benign	Het
Vezt	T	A	10: 93,996,933	E205D	probably benign	Het
Vmn1r177	A	G	7: 23,866,110	F114L	probably benign	Het
Vmn2r53	C	A	7: 12,581,586	E769*	probably null	Het
Vnn3	T	C	10: 23,865,942	Y382H	probably damaging	Het

Other mutations in Amph

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Amph	APN	13	19120606	missense	probably damaging	1.00
IGL01866:Amph	APN	13	19142002	missense	probably damaging	1.00
IGL02157:Amph	APN	13	19104231	missense	possibly damaging	0.60
IGL02300:Amph	APN	13	19086604	missense	probably damaging	1.00
IGL02435:Amph	APN	13	19139163	splice site	probably benign
IGL03060:Amph	APN	13	19094814	missense	probably damaging	0.99
IGL03122:Amph	APN	13	19102943	missense	probably damaging	0.98
R0037:Amph	UTSW	13	19100653	missense	possibly damaging	0.90
R0646:Amph	UTSW	13	19113116	missense	possibly damaging	0.95
R0652:Amph	UTSW	13	19086621	splice site	probably null
R1005:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1199:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1200:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1201:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1333:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1334:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1335:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1337:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1338:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1384:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1397:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1501:Amph	UTSW	13	19104291	nonsense	probably null
R1528:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R1822:Amph	UTSW	13	18948455	missense	probably damaging	0.98
R2004:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2006:Amph	UTSW	13	19142028	missense	probably damaging	0.97
R2061:Amph	UTSW	13	19125035	nonsense	probably null
R2111:Amph	UTSW	13	19116266	splice site	probably benign
R2329:Amph	UTSW	13	19139350	missense	probably benign
R2878:Amph	UTSW	13	19104267	missense	possibly damaging	0.95
R3121:Amph	UTSW	13	19113146	nonsense	probably null
R3548:Amph	UTSW	13	19102959	missense	probably damaging	1.00
R4059:Amph	UTSW	13	19141998	missense	probably damaging	1.00
R4369:Amph	UTSW	13	19137700	missense	probably benign	0.20
R4492:Amph	UTSW	13	19149758	missense	possibly damaging	0.76
R4855:Amph	UTSW	13	19084208	missense	probably damaging	1.00
R4937:Amph	UTSW	13	19104345	missense	probably damaging	1.00
R4965:Amph	UTSW	13	19137699	missense	probably benign	0.12
R5777:Amph	UTSW	13	19046016	missense	probably damaging	1.00
R5787:Amph	UTSW	13	18948454	missense	possibly damaging	0.75
R6091:Amph	UTSW	13	19125123	missense	probably benign	0.01
R7103:Amph	UTSW	13	19149738	missense	probably benign	0.00
R7451:Amph	UTSW	13	19077368	missense	probably damaging	1.00
R7522:Amph	UTSW	13	19086545	missense	probably damaging	0.96
R8165:Amph	UTSW	13	19094837	missense	probably benign	0.05
R8166:Amph	UTSW	13	18948490	missense	possibly damaging	0.91
R8214:Amph	UTSW	13	19104298	missense	possibly damaging	0.81
R9021:Amph	UTSW	13	19099901	missense	probably benign	0.35
R9241:Amph	UTSW	13	19094802	missense	probably damaging	1.00
R9469:Amph	UTSW	13	19086599	missense	probably damaging	1.00
R9717:Amph	UTSW	13	19125083	missense	probably benign	0.07
R9755:Amph	UTSW	13	19113155	missense	probably damaging	1.00
V1662:Amph	UTSW	13	19139370	missense	probably benign	0.36
Z1177:Amph	UTSW	13	19139334	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GTCCCAGTACTAGCTGAATGG -3'
(R):5'- CCGCTATGAACGCAGGAAAC -3'

Sequencing Primer
(F):5'- CCCAGTACTAGCTGAATGGGTTATTG -3'
(R):5'- CTATGAACGCAGGAAACAGAGTAAG -3'

Posted On

2019-05-15