Mutagenetix > Incidental Mutation

Incidental Mutation 'R7100:Phf20l1'

550785

Institutional Source

Beutler Lab

Gene Symbol

Phf20l1

Ensembl Gene

ENSMUSG00000072501

Gene Name

PHD finger protein 20-like 1

Synonyms

CGI-72, E130113K22Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.296) question?

Stock #

R7100 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66577560-66647976 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66604840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 262 (N262S)

Ref Sequence

ENSEMBL: ENSMUSP00000035682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230882] [ENSMUST00000230948]

AlphaFold

Q8CCJ9

Predicted Effect

probably benign
Transcript: ENSMUST00000048188
AA Change: N262S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: N262S

Domain	Start	End	E-Value	Type
TUDOR	11	71	7.67e0	SMART
Agenet	11	73	3.53e0	SMART
Agenet	85	141	4.54e-1	SMART
TUDOR	85	141	5.75e-8	SMART
Pfam:DUF3776	210	319	1.3e-31	PFAM
Pfam:PHD20L1_u1	318	413	4.7e-47	PFAM
low complexity region	443	453	N/A	INTRINSIC
low complexity region	530	543	N/A	INTRINSIC
low complexity region	547	585	N/A	INTRINSIC
low complexity region	598	608	N/A	INTRINSIC
low complexity region	642	658	N/A	INTRINSIC
PHD	683	727	8.45e-3	SMART
low complexity region	879	887	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229160
AA Change: N261S

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000229576
AA Change: N262S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000230882
AA Change: N261S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230948
AA Change: N235S

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl10	A	G	2: 154,552,395	E89G	probably damaging	Het
Adgrv1	A	T	13: 81,270,897	V5993E	probably damaging	Het
Amdhd1	T	C	10: 93,537,074		probably null	Het
Amph	T	C	13: 19,149,841	*691Q	probably null	Het
Ankrd55	A	G	13: 112,356,110	K272E	probably benign	Het
Arhgef10l	C	T	4: 140,516,815	V838I	possibly damaging	Het
Arl2	C	A	19: 6,134,744	V160F	probably benign	Het
BC067074	T	A	13: 113,318,967	F516I		Het
Catsperb	T	C	12: 101,446,038	V128A	possibly damaging	Het
Cdk11b	T	A	4: 155,625,593	L17H	probably damaging	Het
Cpsf1	A	T	15: 76,596,114	N1391K	possibly damaging	Het
Cpxm2	C	T	7: 132,054,815	A573T	probably benign	Het
Daxx	T	C	17: 33,911,442	S144P	probably damaging	Het
Dpp3	T	C	19: 4,918,041	D303G	probably damaging	Het
Fam126b	T	A	1: 58,534,494	T384S	possibly damaging	Het
Fam181a	T	A	12: 103,315,873	N12K	probably damaging	Het
Flg2	A	T	3: 93,203,711	R1015S	unknown	Het
Fstl5	A	G	3: 76,536,293	H315R	probably benign	Het
Fut4	A	G	9: 14,751,393	S202P	probably damaging	Het
Gm5114	T	C	7: 39,408,284	D637G	possibly damaging	Het
Gstcd	G	T	3: 133,084,943	T21K	probably benign	Het
Heca	C	T	10: 17,915,373	V312M	probably benign	Het
Herpud1	A	G	8: 94,390,847	R144G	probably damaging	Het
Hrasls5	T	A	19: 7,639,558	F313I	unknown	Het
Ino80	A	G	2: 119,374,513	S1511P	possibly damaging	Het
Irf2bp2	T	C	8: 126,591,733	T365A	probably benign	Het
Klk1	G	A	7: 44,229,424	G214E	probably damaging	Het
Lama3	A	T	18: 12,582,644	N1719I	possibly damaging	Het
Lmna	A	G	3: 88,484,990	I365T	probably damaging	Het
Lrp8	C	A	4: 107,802,450	A13E	possibly damaging	Het
Ly75	A	G	2: 60,306,434	L1483P	probably benign	Het
Mid1	A	G	X: 169,985,077	D407G	probably benign	Het
Mpl	G	T	4: 118,457,410	A21E		Het
Mus81	C	T	19: 5,484,211	G360S	probably damaging	Het
Nmt2	T	A	2: 3,312,913	S250T	probably benign	Het
Nr1d1	C	A	11: 98,771,334	R158L	probably damaging	Het
Pcgf6	G	A	19: 47,050,714	P36S	unknown	Het
Pcnx2	G	A	8: 125,759,114	A1915V	probably benign	Het
Peak1	A	G	9: 56,259,393	V417A	probably damaging	Het
Ppp2r5d	A	G	17: 46,685,682	V355A	probably benign	Het
Rasa3	T	C	8: 13,586,897	T395A	probably benign	Het
Rims1	T	A	1: 22,346,473	I432F	probably benign	Het
Rnf123	C	T	9: 108,056,639	C1080Y	probably damaging	Het
Serpina3g	T	C	12: 104,238,311		probably benign	Het
Shank2	T	A	7: 144,411,164	D836E	possibly damaging	Het
Slc24a5	A	C	2: 125,080,671	S118R	probably damaging	Het
Smg1	G	T	7: 118,184,520	H1048N	unknown	Het
Specc1l	T	G	10: 75,245,495	S242A	probably benign	Het
Tagap1	A	T	17: 6,956,712	L195Q	possibly damaging	Het
Tmem57	T	C	4: 134,806,660	D550G	probably damaging	Het
Trpc3	C	A	3: 36,650,067	E580D	probably benign	Het
Ttn	A	T	2: 76,710,822	V33940E	probably benign	Het
Upp2	G	T	2: 58,791,805	R318L	probably benign	Het
Vezt	T	A	10: 93,996,933	E205D	probably benign	Het
Vmn1r177	A	G	7: 23,866,110	F114L	probably benign	Het
Vmn2r53	C	A	7: 12,581,586	E769*	probably null	Het
Vnn3	T	C	10: 23,865,942	Y382H	probably damaging	Het

Other mutations in Phf20l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Phf20l1	APN	15	66629035	missense	probably benign	0.28
IGL00484:Phf20l1	APN	15	66615633	splice site	probably benign
IGL00668:Phf20l1	APN	15	66632849	missense	probably damaging	0.99
IGL00849:Phf20l1	APN	15	66636832	missense	probably benign	0.00
IGL00954:Phf20l1	APN	15	66641908	missense	probably damaging	1.00
IGL01025:Phf20l1	APN	15	66613132	missense	probably damaging	1.00
IGL01504:Phf20l1	APN	15	66597691	missense	possibly damaging	0.73
IGL02087:Phf20l1	APN	15	66628991	missense	probably damaging	1.00
IGL02273:Phf20l1	APN	15	66640025	missense	probably damaging	1.00
IGL02276:Phf20l1	APN	15	66615410	critical splice donor site	probably null
IGL02372:Phf20l1	APN	15	66641801	missense	probably damaging	1.00
IGL02589:Phf20l1	APN	15	66615632	splice site	probably benign
IGL02656:Phf20l1	APN	15	66629827	missense	probably damaging	1.00
IGL02691:Phf20l1	APN	15	66604864	missense	probably damaging	1.00
IGL02881:Phf20l1	APN	15	66594980	critical splice donor site	probably null
IGL02940:Phf20l1	APN	15	66595151	missense	probably damaging	1.00
IGL02943:Phf20l1	APN	15	66594884	missense	probably damaging	1.00
IGL03030:Phf20l1	APN	15	66641947	utr 3 prime	probably benign
IGL03034:Phf20l1	APN	15	66597403	missense	probably damaging	1.00
Abbreviated	UTSW	15	66632903	critical splice donor site	probably null
acadia	UTSW	15	66636820	missense	possibly damaging	0.85
curt	UTSW	15	66639948	missense	possibly damaging	0.90
Cut	UTSW	15	66613039	nonsense	probably null
shorthand	UTSW	15	66609547	missense	probably damaging	1.00
slang	UTSW	15	66641932	missense	probably benign	0.03
PIT4305001:Phf20l1	UTSW	15	66613052	missense	possibly damaging	0.94
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0070:Phf20l1	UTSW	15	66639991	missense	probably damaging	1.00
R0562:Phf20l1	UTSW	15	66609604	missense	probably damaging	1.00
R0605:Phf20l1	UTSW	15	66595122	missense	probably damaging	1.00
R0787:Phf20l1	UTSW	15	66615630	splice site	probably benign
R1458:Phf20l1	UTSW	15	66604813	missense	probably damaging	1.00
R1619:Phf20l1	UTSW	15	66615259	missense	possibly damaging	0.88
R1781:Phf20l1	UTSW	15	66632825	missense	probably damaging	1.00
R2360:Phf20l1	UTSW	15	66594920	missense	probably damaging	1.00
R3973:Phf20l1	UTSW	15	66641816	missense	probably damaging	1.00
R4374:Phf20l1	UTSW	15	66604837	missense	possibly damaging	0.72
R4375:Phf20l1	UTSW	15	66615222	missense	probably benign	0.00
R4554:Phf20l1	UTSW	15	66597367	missense	probably damaging	1.00
R4913:Phf20l1	UTSW	15	66604855	missense	probably benign	0.03
R5092:Phf20l1	UTSW	15	66636913	missense	possibly damaging	0.46
R5491:Phf20l1	UTSW	15	66615785	missense	possibly damaging	0.67
R5713:Phf20l1	UTSW	15	66636820	missense	possibly damaging	0.85
R6126:Phf20l1	UTSW	15	66636824	missense	probably benign	0.02
R6213:Phf20l1	UTSW	15	66632903	critical splice donor site	probably null
R6569:Phf20l1	UTSW	15	66629824	missense	probably damaging	1.00
R6572:Phf20l1	UTSW	15	66609547	missense	probably damaging	1.00
R6808:Phf20l1	UTSW	15	66630913	missense	probably damaging	0.99
R7208:Phf20l1	UTSW	15	66604789	missense	probably benign	0.05
R7436:Phf20l1	UTSW	15	66597750	missense	possibly damaging	0.92
R7466:Phf20l1	UTSW	15	66636884	missense	probably damaging	1.00
R7604:Phf20l1	UTSW	15	66604084	missense	probably benign	0.02
R7863:Phf20l1	UTSW	15	66615235	missense	possibly damaging	0.94
R7991:Phf20l1	UTSW	15	66630919	missense	possibly damaging	0.64
R8015:Phf20l1	UTSW	15	66639948	missense	possibly damaging	0.90
R8161:Phf20l1	UTSW	15	66604073	missense	probably damaging	1.00
R8228:Phf20l1	UTSW	15	66639940	missense	possibly damaging	0.81
R8857:Phf20l1	UTSW	15	66641932	missense	probably benign	0.03
R9295:Phf20l1	UTSW	15	66641903	missense	probably damaging	1.00
R9393:Phf20l1	UTSW	15	66604106	missense	probably damaging	1.00
R9442:Phf20l1	UTSW	15	66613039	nonsense	probably null
R9522:Phf20l1	UTSW	15	66632820	missense	possibly damaging	0.89
R9727:Phf20l1	UTSW	15	66615382	missense	probably benign	0.01
X0065:Phf20l1	UTSW	15	66597678	missense	probably damaging	0.99
X0065:Phf20l1	UTSW	15	66629806	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTATCAGTCACGAGGGATTTG -3'
(R):5'- CATCAATGTGTTACCCTGAGCCAG -3'

Sequencing Primer
(F):5'- ATCAGTCACGAGGGATTTGTGTTTG -3'
(R):5'- GTGTTACCCTGAGCCAGAAGATTC -3'

Posted On

2019-05-15