Incidental Mutation 'R0595:Tanc2'
ID55079
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission 038785-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0595 (G1)
Quality Score91
Status Validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 105714177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330] [ENSMUST00000167695] [ENSMUST00000167695] [ENSMUST00000168598] [ENSMUST00000207807]
Predicted Effect probably benign
Transcript: ENSMUST00000100330
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124367
Predicted Effect probably null
Transcript: ENSMUST00000167695
Predicted Effect probably null
Transcript: ENSMUST00000167695
Predicted Effect probably benign
Transcript: ENSMUST00000168598
SMART Domains Protein: ENSMUSP00000129877
Gene: ENSMUSG00000053580

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207807
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7017:Tanc2 UTSW 11 105923108 missense probably benign
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
R7757:Tanc2 UTSW 11 105776858 missense possibly damaging 0.81
R7807:Tanc2 UTSW 11 105867654 missense probably benign 0.00
R7878:Tanc2 UTSW 11 105913415 missense
R7895:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
R7961:Tanc2 UTSW 11 105913415 missense
R7978:Tanc2 UTSW 11 105921825 missense probably damaging 1.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCACATTCACAGACGGAGACATTGG -3'
(R):5'- AGAGGATGCTGCCTAAAATGCCAC -3'

Sequencing Primer
(F):5'- GTTCAGCAAATGTATAGACATGAGCC -3'
(R):5'- TGCCACAGTGAAAGTCGTC -3'
Posted On2013-07-11