Incidental Mutation 'R7100:Pcgf6'
ID 550795
Institutional Source Beutler Lab
Gene Symbol Pcgf6
Ensembl Gene ENSMUSG00000025050
Gene Name polycomb group ring finger 6
Synonyms Rnf134, Mel18 and Bmi1-like RING finger protein, MBLR, 4933407A11Rik
MMRRC Submission 045192-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R7100 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 47022056-47039345 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 47039153 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 36 (P36S)
Ref Sequence ENSEMBL: ENSMUSP00000026032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026032]
AlphaFold Q99NA9
Predicted Effect unknown
Transcript: ENSMUST00000026032
AA Change: P36S
SMART Domains Protein: ENSMUSP00000026032
Gene: ENSMUSG00000025050
AA Change: P36S

DomainStartEndE-ValueType
low complexity region 24 52 N/A INTRINSIC
coiled coil region 71 113 N/A INTRINSIC
RING 137 175 3.58e-6 SMART
Pfam:RAWUL 263 333 2.8e-10 PFAM
Meta Mutation Damage Score 0.0801 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif, which is most closely related to those of polycomb group (PcG) proteins RNF110/MEL-18 and BMI1. PcG proteins are known to form protein complexes and function as transcription repressors. This protein has been shown to interact with some PcG proteins and act as a transcription repressor. The activity of this protein is found to be regulated by cell cycle dependent phosphorylation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 A G 2: 154,394,315 (GRCm39) E89G probably damaging Het
Adgrv1 A T 13: 81,419,016 (GRCm39) V5993E probably damaging Het
Amdhd1 T C 10: 93,372,936 (GRCm39) probably null Het
Amph T C 13: 19,334,011 (GRCm39) *691Q probably null Het
Ankrd55 A G 13: 112,492,644 (GRCm39) K272E probably benign Het
Arhgef10l C T 4: 140,244,126 (GRCm39) V838I possibly damaging Het
Arl2 C A 19: 6,184,774 (GRCm39) V160F probably benign Het
Catsperb T C 12: 101,412,297 (GRCm39) V128A possibly damaging Het
Cdk11b T A 4: 155,710,050 (GRCm39) L17H probably damaging Het
Cpsf1 A T 15: 76,480,314 (GRCm39) N1391K possibly damaging Het
Cpxm2 C T 7: 131,656,544 (GRCm39) A573T probably benign Het
Cspg4b T A 13: 113,455,501 (GRCm39) F516I Het
Daxx T C 17: 34,130,416 (GRCm39) S144P probably damaging Het
Dpp3 T C 19: 4,968,069 (GRCm39) D303G probably damaging Het
Fam181a T A 12: 103,282,132 (GRCm39) N12K probably damaging Het
Flg2 A T 3: 93,111,018 (GRCm39) R1015S unknown Het
Fstl5 A G 3: 76,443,600 (GRCm39) H315R probably benign Het
Fut4 A G 9: 14,662,689 (GRCm39) S202P probably damaging Het
Gm5114 T C 7: 39,057,708 (GRCm39) D637G possibly damaging Het
Gstcd G T 3: 132,790,704 (GRCm39) T21K probably benign Het
Heca C T 10: 17,791,121 (GRCm39) V312M probably benign Het
Herpud1 A G 8: 95,117,475 (GRCm39) R144G probably damaging Het
Hycc2 T A 1: 58,573,653 (GRCm39) T384S possibly damaging Het
Ino80 A G 2: 119,204,994 (GRCm39) S1511P possibly damaging Het
Irf2bp2 T C 8: 127,318,472 (GRCm39) T365A probably benign Het
Klk1 G A 7: 43,878,848 (GRCm39) G214E probably damaging Het
Lama3 A T 18: 12,715,701 (GRCm39) N1719I possibly damaging Het
Lmna A G 3: 88,392,297 (GRCm39) I365T probably damaging Het
Lrp8 C A 4: 107,659,647 (GRCm39) A13E possibly damaging Het
Ly75 A G 2: 60,136,778 (GRCm39) L1483P probably benign Het
Maco1 T C 4: 134,533,971 (GRCm39) D550G probably damaging Het
Mid1 A G X: 168,768,073 (GRCm39) D407G probably benign Het
Mpl G T 4: 118,314,607 (GRCm39) A21E Het
Mus81 C T 19: 5,534,239 (GRCm39) G360S probably damaging Het
Nmt2 T A 2: 3,313,950 (GRCm39) S250T probably benign Het
Nr1d1 C A 11: 98,662,160 (GRCm39) R158L probably damaging Het
Pcnx2 G A 8: 126,485,853 (GRCm39) A1915V probably benign Het
Peak1 A G 9: 56,166,677 (GRCm39) V417A probably damaging Het
Phf20l1 A G 15: 66,476,689 (GRCm39) N262S probably benign Het
Plaat5 T A 19: 7,616,923 (GRCm39) F313I unknown Het
Ppp2r5d A G 17: 46,996,608 (GRCm39) V355A probably benign Het
Rasa3 T C 8: 13,636,897 (GRCm39) T395A probably benign Het
Rims1 T A 1: 22,416,697 (GRCm39) I432F probably benign Het
Rnf123 C T 9: 107,933,838 (GRCm39) C1080Y probably damaging Het
Serpina3g T C 12: 104,204,570 (GRCm39) probably benign Het
Shank2 T A 7: 143,964,901 (GRCm39) D836E possibly damaging Het
Slc24a5 A C 2: 124,922,591 (GRCm39) S118R probably damaging Het
Smg1 G T 7: 117,783,743 (GRCm39) H1048N unknown Het
Specc1l T G 10: 75,081,329 (GRCm39) S242A probably benign Het
Tagap1 A T 17: 7,224,111 (GRCm39) L195Q possibly damaging Het
Trpc3 C A 3: 36,704,216 (GRCm39) E580D probably benign Het
Ttn A T 2: 76,541,166 (GRCm39) V33940E probably benign Het
Upp2 G T 2: 58,681,817 (GRCm39) R318L probably benign Het
Vezt T A 10: 93,832,795 (GRCm39) E205D probably benign Het
Vmn1r177 A G 7: 23,565,535 (GRCm39) F114L probably benign Het
Vmn2r53 C A 7: 12,315,513 (GRCm39) E769* probably null Het
Vnn3 T C 10: 23,741,840 (GRCm39) Y382H probably damaging Het
Other mutations in Pcgf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Pcgf6 APN 19 47,039,243 (GRCm39) missense unknown
IGL02228:Pcgf6 APN 19 47,036,421 (GRCm39) missense probably damaging 1.00
IGL02366:Pcgf6 APN 19 47,038,894 (GRCm39) missense possibly damaging 0.56
IGL03152:Pcgf6 APN 19 47,037,344 (GRCm39) splice site probably benign
R0220:Pcgf6 UTSW 19 47,028,529 (GRCm39) missense probably benign 0.26
R1651:Pcgf6 UTSW 19 47,037,441 (GRCm39) missense probably damaging 1.00
R1668:Pcgf6 UTSW 19 47,028,544 (GRCm39) missense probably damaging 1.00
R1711:Pcgf6 UTSW 19 47,038,957 (GRCm39) missense probably damaging 0.96
R3157:Pcgf6 UTSW 19 47,028,475 (GRCm39) splice site probably benign
R4745:Pcgf6 UTSW 19 47,036,545 (GRCm39) critical splice donor site probably null
R5620:Pcgf6 UTSW 19 47,036,406 (GRCm39) missense probably damaging 1.00
R6450:Pcgf6 UTSW 19 47,037,527 (GRCm39) missense probably benign 0.00
R7073:Pcgf6 UTSW 19 47,031,226 (GRCm39) missense possibly damaging 0.56
R8079:Pcgf6 UTSW 19 47,034,271 (GRCm39) missense probably damaging 1.00
R8347:Pcgf6 UTSW 19 47,034,277 (GRCm39) missense possibly damaging 0.86
R8745:Pcgf6 UTSW 19 47,039,159 (GRCm39) missense probably benign 0.23
R9079:Pcgf6 UTSW 19 47,039,053 (GRCm39) missense possibly damaging 0.49
R9430:Pcgf6 UTSW 19 47,039,219 (GRCm39) missense unknown
R9619:Pcgf6 UTSW 19 47,037,261 (GRCm39) missense possibly damaging 0.73
R9753:Pcgf6 UTSW 19 47,023,073 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGATCTGCAAGGACTCCAC -3'
(R):5'- TAGGTAGCCTAGGTGAACCACAC -3'

Sequencing Primer
(F):5'- CAGAGAGAAGTGGCTCATCTCTTC -3'
(R):5'- CTGCGCACTGGTACGAAAG -3'
Posted On 2019-05-15