Mutagenetix > Incidental Mutations

Incidental Mutation 'R0595:Apob'

55080

Institutional Source

Beutler Lab

Gene Symbol

Apob

Ensembl Gene

ENSMUSG00000020609

Gene Name

apolipoprotein B

Synonyms

apob-100, apob-48

MMRRC Submission

038785-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.902) question?

Stock #

R0595 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7977648-8016835 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 8008369 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 2251 (V2251I)

Ref Sequence

ENSEMBL: ENSMUSP00000035761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037520] [ENSMUST00000037811] [ENSMUST00000171239]

Predicted Effect

probably benign
Transcript: ENSMUST00000037520
AA Change: V2251I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035761
Gene: ENSMUSG00000020609
AA Change: V2251I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	33	585	6.03e-94	SMART
DUF1943	619	932	7.88e-97	SMART
Pfam:DUF1081	945	1059	9.4e-32	PFAM
low complexity region	1100	1109	N/A	INTRINSIC
Blast:LPD_N	1249	1311	9e-22	BLAST
low complexity region	1632	1644	N/A	INTRINSIC
internal_repeat_1	1882	2038	6.61e-9	PROSPERO
SCOP:d1gw5a_	2105	2577	9e-5	SMART
internal_repeat_1	2973	3150	6.61e-9	PROSPERO
low complexity region	3561	3580	N/A	INTRINSIC
low complexity region	3928	3936	N/A	INTRINSIC
Pfam:ApoB100_C	4401	4456	5.6e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000037811
AA Change: V2284I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036044
Gene: ENSMUSG00000020609
AA Change: V2284I

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LPD_N	46	598	6.03e-94	SMART
DUF1943	632	945	7.88e-97	SMART
Pfam:DUF1081	960	1070	6.3e-39	PFAM
low complexity region	1113	1122	N/A	INTRINSIC
Blast:LPD_N	1282	1344	1e-21	BLAST
low complexity region	1665	1677	N/A	INTRINSIC
internal_repeat_1	1915	2071	6.6e-9	PROSPERO
SCOP:d1gw5a_	2138	2610	9e-5	SMART
internal_repeat_1	3006	3183	6.6e-9	PROSPERO
low complexity region	3594	3613	N/A	INTRINSIC
low complexity region	3961	3969	N/A	INTRINSIC
Pfam:ApoB100_C	4434	4490	1.6e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171239

SMART Domains

Protein: ENSMUSP00000129496
Gene: ENSMUSG00000020609

Domain	Start	End	E-Value	Type
low complexity region	348	356	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100. Unlike the apoB-48 and apoB-100 structural equivalents in human, which are synthesized exclusively in the gut and liver, respectively, the mouse apoB-48 isoform is also found in mouse liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2179 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants usually die by midgestation and longer survivors exhibit exencephaly. Heterozygotes show reduced plasma cholesterol and apolipoprotein levels. Single isoform B100 and B48 null mutants are viable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	T	A	5: 8,740,417	D1093E	probably damaging	Het
Aldh2	G	T	5: 121,573,500	A276D	probably damaging	Het
Aldh2	C	T	5: 121,573,501	A276T	probably damaging	Het
Aldh7a1	C	T	18: 56,546,893		probably benign	Het
Ano1	C	T	7: 144,590,153	R964H	possibly damaging	Het
Atp6v1e1	A	G	6: 120,801,130	V148A	probably benign	Het
Bbs9	T	A	9: 22,496,815	H73Q	probably benign	Het
Brca1	A	G	11: 101,524,887	V807A	probably benign	Het
Cacna1b	C	T	2: 24,649,989		probably benign	Het
Cadps2	A	T	6: 23,321,704		probably null	Het
Cep152	T	C	2: 125,595,063	Q519R	probably damaging	Het
Cep295	A	C	9: 15,332,191	Y1608*	probably null	Het
Cfap54	T	C	10: 92,884,736	I2619V	unknown	Het
Dnajb9	A	G	12: 44,208,284	V7A	probably benign	Het
Ep400	T	C	5: 110,703,542	K1358R	unknown	Het
Fbxw7	C	A	3: 84,977,367		probably null	Het
Fsip2	T	C	2: 82,946,952	Y108H	probably damaging	Het
Ggt6	T	A	11: 72,437,667	L331Q	probably damaging	Het
Ifitm1	T	A	7: 140,968,329	I25N	possibly damaging	Het
Krt75	C	T	15: 101,568,354	E367K	probably damaging	Het
Lifr	A	G	15: 7,177,469	Y487C	probably damaging	Het
Map3k6	G	T	4: 133,241,263	G59W	probably damaging	Het
Mme	A	G	3: 63,328,181	T129A	probably benign	Het
Mmp10	G	A	9: 7,508,198	E442K	probably benign	Het
Myh13	T	C	11: 67,344,846	S646P	probably benign	Het
Nbea	A	T	3: 55,628,496	I2889N	probably benign	Het
Nlrp4d	T	A	7: 10,381,045	K581N	probably benign	Het
Nr3c2	C	T	8: 76,909,604	P445S	possibly damaging	Het
Olfr487	A	T	7: 108,211,661	N289K	probably damaging	Het
Pck1	T	A	2: 173,157,029	V360E	probably damaging	Het
Plekha7	T	C	7: 116,144,968	D766G	probably damaging	Het
Prag1	A	G	8: 36,147,002	N1236S	probably damaging	Het
Prkdc	A	C	16: 15,808,088	Q3326P	probably damaging	Het
Prrc2b	T	C	2: 32,183,177	M57T	probably damaging	Het
Rb1	A	T	14: 73,273,680	F330I	probably damaging	Het
Rufy4	A	G	1: 74,140,930	E448G	possibly damaging	Het
Scn10a	T	A	9: 119,666,063	M371L	probably benign	Het
Sgta	T	C	10: 81,048,908	D189G	probably damaging	Het
Spata31d1b	A	G	13: 59,716,277	H413R	probably benign	Het
Stau2	T	C	1: 16,440,450	T95A	probably damaging	Het
Supt4a	C	T	11: 87,743,156		probably null	Het
Tanc2	A	G	11: 105,714,177		probably null	Het
Tap2	T	A	17: 34,212,354	V422D	probably damaging	Het
Tas2r138	A	G	6: 40,612,865	L149P	probably damaging	Het
Tex15	T	C	8: 33,572,617	S692P	probably damaging	Het
Tgm2	C	T	2: 158,143,042	R48H	probably damaging	Het
Ticrr	T	A	7: 79,695,563	F1725L	possibly damaging	Het
Tnpo2	T	A	8: 85,052,041	C672*	probably null	Het
Xkr9	A	G	1: 13,700,784	I175V	probably benign	Het
Zfp428	T	A	7: 24,515,378	S140T	probably benign	Het

Other mutations in Apob

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Apob	APN	12	7993065	splice site	probably benign
IGL00421:Apob	APN	12	8010197	missense	probably damaging	0.99
IGL00658:Apob	APN	12	8009471	missense	probably benign	0.08
IGL00768:Apob	APN	12	8002107	missense	probably damaging	1.00
IGL00833:Apob	APN	12	8010101	missense	probably benign	0.14
IGL00926:Apob	APN	12	8015421	missense	probably benign	0.01
IGL01065:Apob	APN	12	8003299	missense	probably damaging	0.99
IGL01313:Apob	APN	12	8000898	missense	probably damaging	1.00
IGL01419:Apob	APN	12	8002251	missense	probably damaging	0.99
IGL01461:Apob	APN	12	8001884	missense	probably benign	0.13
IGL02002:Apob	APN	12	7994822	missense	probably benign	0.03
IGL02031:Apob	APN	12	8015222	missense	probably benign
IGL02102:Apob	APN	12	7989407	missense	possibly damaging	0.94
IGL02115:Apob	APN	12	7992923	missense	probably benign	0.06
IGL02513:Apob	APN	12	7992979	missense	probably benign	0.01
IGL02967:Apob	APN	12	8015366	nonsense	probably null
IGL03005:Apob	APN	12	7993059	splice site	probably benign
IGL03011:Apob	APN	12	7997883	missense	probably damaging	1.00
IGL03116:Apob	APN	12	8016350	missense	probably damaging	0.98
IGL03215:Apob	APN	12	8013818	missense	possibly damaging	0.92
IGL03227:Apob	APN	12	8016089	missense	probably benign	0.04
Aesthete	UTSW	12	8010080	nonsense	probably null
Essence	UTSW	12	8007769	nonsense	probably null
Ethos	UTSW	12	7990394	missense	probably null	1.00
IGL02835:Apob	UTSW	12	8015097	missense	possibly damaging	0.86
IGL02837:Apob	UTSW	12	8005102	missense	probably damaging	1.00
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0071:Apob	UTSW	12	8002111	missense	probably damaging	0.98
R0116:Apob	UTSW	12	7989113	unclassified	probably benign
R0180:Apob	UTSW	12	8008285	nonsense	probably null
R0288:Apob	UTSW	12	7990779	nonsense	probably null
R0295:Apob	UTSW	12	8002181	nonsense	probably null
R0305:Apob	UTSW	12	8012210	missense	probably damaging	1.00
R0312:Apob	UTSW	12	8009034	missense	probably benign
R0324:Apob	UTSW	12	8010521	missense	probably benign	0.41
R0326:Apob	UTSW	12	7990307	missense	probably damaging	1.00
R0363:Apob	UTSW	12	8010136	missense	probably damaging	1.00
R0390:Apob	UTSW	12	7988678	missense	probably damaging	0.99
R0462:Apob	UTSW	12	8000896	missense	probably damaging	1.00
R0471:Apob	UTSW	12	7990406	missense	probably damaging	1.00
R0532:Apob	UTSW	12	8016188	missense	possibly damaging	0.48
R0548:Apob	UTSW	12	8006282	missense	probably damaging	1.00
R0560:Apob	UTSW	12	8005101	missense	probably damaging	1.00
R0600:Apob	UTSW	12	8006440	missense	probably damaging	1.00
R0626:Apob	UTSW	12	8016193	missense	probably benign	0.45
R0685:Apob	UTSW	12	8010742	missense	probably benign
R0765:Apob	UTSW	12	8016518	missense	probably benign
R0790:Apob	UTSW	12	8010245	missense	probably damaging	1.00
R0918:Apob	UTSW	12	7983941	missense	probably benign	0.10
R0962:Apob	UTSW	12	7989191	missense	probably damaging	0.98
R1055:Apob	UTSW	12	7994963	missense	probably damaging	1.00
R1077:Apob	UTSW	12	8006017	missense	probably benign
R1143:Apob	UTSW	12	8012354	missense	probably benign	0.26
R1163:Apob	UTSW	12	8011654	missense	probably damaging	1.00
R1266:Apob	UTSW	12	8006093	missense	probably benign	0.37
R1434:Apob	UTSW	12	8009715	missense	probably damaging	1.00
R1442:Apob	UTSW	12	7986165	missense	probably benign	0.31
R1445:Apob	UTSW	12	8016084	missense	possibly damaging	0.48
R1459:Apob	UTSW	12	8006047	missense	probably benign
R1459:Apob	UTSW	12	8011937	missense	possibly damaging	0.92
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1465:Apob	UTSW	12	8011421	missense	possibly damaging	0.91
R1508:Apob	UTSW	12	8011481	missense	possibly damaging	0.92
R1518:Apob	UTSW	12	7989207	missense	probably benign	0.01
R1531:Apob	UTSW	12	7997880	missense	possibly damaging	0.65
R1547:Apob	UTSW	12	8003368	missense	probably benign	0.08
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1574:Apob	UTSW	12	7990839	missense	possibly damaging	0.51
R1682:Apob	UTSW	12	8012365	missense	probably benign	0.00
R1709:Apob	UTSW	12	8009306	missense	probably damaging	0.98
R1718:Apob	UTSW	12	8016087	missense	probably benign	0.02
R1752:Apob	UTSW	12	7988766	missense	probably benign	0.01
R1781:Apob	UTSW	12	8009603	missense	possibly damaging	0.96
R1818:Apob	UTSW	12	8006834	missense	probably damaging	0.98
R1818:Apob	UTSW	12	8013064	missense	possibly damaging	0.93
R1842:Apob	UTSW	12	8011559	missense	probably damaging	1.00
R1843:Apob	UTSW	12	8007602	missense	possibly damaging	0.65
R1853:Apob	UTSW	12	8010928	nonsense	probably null
R1990:Apob	UTSW	12	8001039	missense	probably damaging	1.00
R2016:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2017:Apob	UTSW	12	8007751	missense	possibly damaging	0.48
R2023:Apob	UTSW	12	8011090	missense	probably benign	0.01
R2037:Apob	UTSW	12	8007488	missense	probably benign	0.37
R2054:Apob	UTSW	12	8013134	missense	probably damaging	1.00
R2057:Apob	UTSW	12	8002164	nonsense	probably null
R2085:Apob	UTSW	12	8012240	missense	probably damaging	1.00
R2159:Apob	UTSW	12	8010081	missense	probably benign	0.12
R2209:Apob	UTSW	12	8007752	missense	probably benign	0.28
R2249:Apob	UTSW	12	8007499	missense	probably damaging	1.00
R2254:Apob	UTSW	12	8011256	missense	possibly damaging	0.92
R2265:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2266:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2267:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2268:Apob	UTSW	12	8015475	missense	possibly damaging	0.74
R2296:Apob	UTSW	12	7994879	missense	probably damaging	0.97
R2897:Apob	UTSW	12	8010356	missense	probably damaging	1.00
R3431:Apob	UTSW	12	8010778	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8006327	missense	probably damaging	1.00
R3723:Apob	UTSW	12	8011763	missense	possibly damaging	0.46
R3899:Apob	UTSW	12	8015849	missense	possibly damaging	0.87
R4020:Apob	UTSW	12	7994914	nonsense	probably null
R4050:Apob	UTSW	12	8015390	missense	probably benign	0.02
R4351:Apob	UTSW	12	7993054	missense	probably benign	0.03
R4365:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4366:Apob	UTSW	12	8016083	missense	possibly damaging	0.95
R4456:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4458:Apob	UTSW	12	8015445	missense	probably damaging	1.00
R4600:Apob	UTSW	12	8008568	missense	probably damaging	1.00
R4611:Apob	UTSW	12	8011331	missense	probably damaging	1.00
R4646:Apob	UTSW	12	8012759	missense	probably benign	0.21
R4678:Apob	UTSW	12	7995585	missense	probably damaging	1.00
R4685:Apob	UTSW	12	8006456	missense	probably benign	0.00
R4707:Apob	UTSW	12	8006205	missense	probably damaging	0.96
R4726:Apob	UTSW	12	7990267	missense	probably damaging	0.98
R4792:Apob	UTSW	12	8008051	missense	probably benign	0.26
R4822:Apob	UTSW	12	8015741	missense	probably benign	0.04
R4834:Apob	UTSW	12	8014101	missense	possibly damaging	0.49
R4835:Apob	UTSW	12	8015391	missense	possibly damaging	0.56
R4887:Apob	UTSW	12	8013099	missense	probably damaging	1.00
R4910:Apob	UTSW	12	8007848	missense	probably damaging	1.00
R5072:Apob	UTSW	12	8008714	missense	probably benign	0.00
R5073:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5074:Apob	UTSW	12	8005219	critical splice donor site	probably null
R5101:Apob	UTSW	12	8011934	missense	probably benign	0.09
R5123:Apob	UTSW	12	8007630	splice site	probably null
R5133:Apob	UTSW	12	8008898	missense	probably damaging	0.99
R5135:Apob	UTSW	12	8010086	missense	probably damaging	1.00
R5137:Apob	UTSW	12	8011384	missense	possibly damaging	0.63
R5160:Apob	UTSW	12	8012126	missense	possibly damaging	0.90
R5173:Apob	UTSW	12	8008238	missense	probably benign	0.00
R5202:Apob	UTSW	12	8013737	missense	probably damaging	0.98
R5229:Apob	UTSW	12	7977806	missense	probably benign
R5292:Apob	UTSW	12	8005912	missense	probably benign	0.01
R5378:Apob	UTSW	12	8011865	missense	probably damaging	0.99
R5494:Apob	UTSW	12	8011762	missense	probably damaging	0.99
R5517:Apob	UTSW	12	7990906	missense	probably damaging	1.00
R5576:Apob	UTSW	12	7998662	missense	probably damaging	1.00
R5582:Apob	UTSW	12	8010788	missense	probably damaging	1.00
R5629:Apob	UTSW	12	8007847	missense	probably damaging	1.00
R5678:Apob	UTSW	12	7991494	missense	possibly damaging	0.92
R5732:Apob	UTSW	12	8010353	missense	probably benign	0.15
R5734:Apob	UTSW	12	7988781	missense	probably damaging	1.00
R5742:Apob	UTSW	12	8007191	missense	probably damaging	1.00
R5751:Apob	UTSW	12	8012619	nonsense	probably null
R5776:Apob	UTSW	12	8006149	missense	possibly damaging	0.57
R5778:Apob	UTSW	12	8015074	missense	probably benign	0.45
R5783:Apob	UTSW	12	8001022	missense	probably damaging	1.00
R5786:Apob	UTSW	12	8015304	missense	possibly damaging	0.48
R5837:Apob	UTSW	12	8003277	missense	probably benign	0.04
R5857:Apob	UTSW	12	8015397	missense	probably benign	0.00
R6029:Apob	UTSW	12	8016243	missense	probably damaging	0.99
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6032:Apob	UTSW	12	7995513	missense	probably benign	0.02
R6086:Apob	UTSW	12	8015164	missense	probably benign
R6110:Apob	UTSW	12	8011883	missense	probably damaging	1.00
R6131:Apob	UTSW	12	8015874	missense	probably benign	0.17
R6157:Apob	UTSW	12	8006077	missense	probably benign
R6179:Apob	UTSW	12	8005060	nonsense	probably null
R6247:Apob	UTSW	12	8001801	missense	probably damaging	1.00
R6279:Apob	UTSW	12	8007769	nonsense	probably null
R6300:Apob	UTSW	12	8007769	nonsense	probably null
R6320:Apob	UTSW	12	7989194	missense	probably benign	0.27
R6339:Apob	UTSW	12	8016188	missense	probably damaging	0.99
R6353:Apob	UTSW	12	8009421	missense	probably damaging	1.00
R6395:Apob	UTSW	12	8008507	missense	probably benign	0.45
R6441:Apob	UTSW	12	7987796	missense	probably damaging	1.00
R6492:Apob	UTSW	12	8008261	missense	probably damaging	0.99
R6495:Apob	UTSW	12	7990394	missense	probably null	1.00
R6502:Apob	UTSW	12	8001814	missense	probably damaging	0.99
R6520:Apob	UTSW	12	7983124	missense	probably damaging	1.00
R6644:Apob	UTSW	12	8009077	missense	probably damaging	0.97
R6704:Apob	UTSW	12	8010379	missense	probably damaging	0.98
R6750:Apob	UTSW	12	7997853	missense	probably damaging	1.00
R6759:Apob	UTSW	12	8011049	missense	probably benign	0.06
R6812:Apob	UTSW	12	7983062	missense	probably damaging	0.98
R6865:Apob	UTSW	12	8008847	missense	probably benign	0.05
R6873:Apob	UTSW	12	8015995	missense	probably benign	0.00
R7013:Apob	UTSW	12	8010080	nonsense	probably null
R7067:Apob	UTSW	12	8009423	missense	probably damaging	1.00
R7084:Apob	UTSW	12	8009591	missense	probably benign
R7113:Apob	UTSW	12	7995539	missense	probably damaging	1.00
R7175:Apob	UTSW	12	8007034	missense	probably benign	0.33
R7196:Apob	UTSW	12	7983893	missense	possibly damaging	0.90
R7199:Apob	UTSW	12	8005072	missense	probably damaging	1.00
R7205:Apob	UTSW	12	8005087	missense	probably damaging	0.98
R7251:Apob	UTSW	12	8007037	missense	probably damaging	0.98
R7474:Apob	UTSW	12	8009185	missense	probably benign	0.29
R7484:Apob	UTSW	12	8006884	nonsense	probably null
R7538:Apob	UTSW	12	8002219	missense	probably damaging	0.98
R7636:Apob	UTSW	12	8009516	missense	possibly damaging	0.86
R7646:Apob	UTSW	12	8009189	missense	probably damaging	0.99
R7787:Apob	UTSW	12	7990780	missense	probably damaging	0.97
R7793:Apob	UTSW	12	8008124	missense	probably damaging	0.99
R7836:Apob	UTSW	12	8001885	missense	possibly damaging	0.72
R7895:Apob	UTSW	12	8011933	missense	probably benign	0.00
R8005:Apob	UTSW	12	8009744	missense	probably benign	0.01
R8013:Apob	UTSW	12	8010798	missense	possibly damaging	0.94
R8014:Apob	UTSW	12	8010798	missense	possibly damaging	0.94
R8111:Apob	UTSW	12	8008801	missense	probably benign	0.16
R8117:Apob	UTSW	12	8006435	missense	probably damaging	0.99
R8226:Apob	UTSW	12	8009056	missense	probably benign	0.00
R8244:Apob	UTSW	12	8010548	missense	probably damaging	0.96
R8280:Apob	UTSW	12	8010851	missense	possibly damaging	0.46
R8310:Apob	UTSW	12	8009033	missense	probably benign	0.00
R8327:Apob	UTSW	12	8001015	missense	possibly damaging	0.72
R8329:Apob	UTSW	12	8011135	missense	probably damaging	0.98
R8331:Apob	UTSW	12	8001882	missense	probably benign	0.28
R8351:Apob	UTSW	12	8006356	missense	probably benign	0.29
R8412:Apob	UTSW	12	8008069	missense	probably benign	0.33
R8425:Apob	UTSW	12	7988842	missense	possibly damaging	0.70
R8493:Apob	UTSW	12	8009009	missense	possibly damaging	0.87
R8529:Apob	UTSW	12	8007353	missense	probably damaging	1.00
R8554:Apob	UTSW	12	7987830	missense	probably damaging	0.98
X0027:Apob	UTSW	12	8007975	missense	probably benign
Z1088:Apob	UTSW	12	8005074	missense	possibly damaging	0.91
Z1088:Apob	UTSW	12	8005945	nonsense	probably null
Z1088:Apob	UTSW	12	8012936	missense	possibly damaging	0.95
Z1176:Apob	UTSW	12	7998011	missense	probably damaging	1.00
Z1176:Apob	UTSW	12	8004978	missense	probably benign	0.00
Z1177:Apob	UTSW	12	7988765	missense	probably benign	0.43
Z1177:Apob	UTSW	12	8015249	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAGCAGACTTCCTCAGCAGATTC -3'
(R):5'- TCAGGCTATATCTGTGGGCCAACTC -3'

Sequencing Primer
(F):5'- CATTATCTGAATGCATCTGACTGGG -3'
(R):5'- CCATTAAAACCTGGATGTGTTGGTC -3'

Posted On

2013-07-11