Incidental Mutation 'R7101:Olfr1216'
ID550802
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7101 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89013980 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 28 (V28E)
Ref Sequence ENSEMBL: ENSMUSP00000150674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099800
AA Change: V28E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: V28E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216000
AA Change: V28E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217000
AA Change: V28E

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,511,171 S414R possibly damaging Het
Adam25 A G 8: 40,755,401 D568G probably benign Het
Angpt1 T C 15: 42,523,569 I130V probably benign Het
Ankrd11 G T 8: 122,895,455 Q553K probably benign Het
Ankrd42 A T 7: 92,631,544 H59Q possibly damaging Het
Ankrd52 C T 10: 128,382,380 R318C probably damaging Het
Arrdc5 G A 17: 56,294,522 T201M probably damaging Het
Atxn1l A G 8: 109,732,500 S377P probably benign Het
Baz2a T C 10: 128,121,187 F936S possibly damaging Het
Bicc1 T C 10: 70,930,653 D913G probably damaging Het
Blnk T A 19: 40,972,638 M21L probably benign Het
Cabin1 T C 10: 75,751,567 H132R probably benign Het
Ccdc154 A G 17: 25,163,468 H88R probably benign Het
Clic5 G T 17: 44,275,292 A223S probably benign Het
Col28a1 T A 6: 8,014,795 Y870F possibly damaging Het
Dhx37 G A 5: 125,424,942 Q497* probably null Het
Dnah11 T C 12: 118,068,145 T1763A probably benign Het
Dnajc13 T C 9: 104,165,022 R2005G possibly damaging Het
Dopey1 G A 9: 86,507,669 G541S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Ephb3 C T 16: 21,218,518 H455Y possibly damaging Het
Eri1 A C 8: 35,482,623 C127G probably damaging Het
Faf1 A T 4: 109,925,956 E548D probably benign Het
Gm3285 C A 10: 77,862,360 C114* probably null Het
Gm9736 C T 10: 77,751,333 V8I unknown Het
Gnptab A T 10: 88,440,312 M1154L probably benign Het
Grin1 G A 2: 25,296,635 T770M probably damaging Het
Haus1 A G 18: 77,766,870 S67P possibly damaging Het
Homer1 C A 13: 93,356,054 Q184K probably benign Het
Hook2 A G 8: 84,997,051 T401A probably benign Het
Il6st G A 13: 112,495,373 probably null Het
Kcnh8 A T 17: 52,905,010 D612V probably damaging Het
Ltbr C G 6: 125,312,800 E144Q probably benign Het
Mcf2l G T 8: 13,013,579 R961L possibly damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1b G T 1: 51,758,001 Q961K probably benign Het
Myo1h C A 5: 114,342,197 T531N Het
Ngly1 G A 14: 16,283,445 R408Q probably damaging Het
Nup133 T C 8: 123,906,227 E1055G possibly damaging Het
Nutm2 A G 13: 50,472,898 K363R probably benign Het
Obox8 A T 7: 14,332,827 Y97* probably null Het
Odc1 A G 12: 17,547,318 D7G probably benign Het
Ogfod2 C T 5: 124,114,495 T182I unknown Het
Olfr331 A G 11: 58,502,553 M7T probably benign Het
Olfr875 T C 9: 37,772,991 S111P probably damaging Het
Olfr910 G A 9: 38,539,670 M258I probably benign Het
Parp4 A G 14: 56,589,973 D188G probably benign Het
Phactr2 T C 10: 13,247,178 E400G probably benign Het
Phlpp1 G A 1: 106,172,667 V222M possibly damaging Het
Ppp1r16b T C 2: 158,761,763 V536A probably damaging Het
Prex2 T C 1: 11,153,609 V719A possibly damaging Het
Prpf8 C T 11: 75,490,400 A242V possibly damaging Het
Prr14l A G 5: 32,829,427 L908P probably damaging Het
Prrc2b A G 2: 32,226,993 N2146D possibly damaging Het
Rtkn T C 6: 83,150,012 V333A possibly damaging Het
Samd8 T C 14: 21,775,374 Y196H probably benign Het
Six5 A G 7: 19,094,859 T75A probably benign Het
Slc35a4 T A 18: 36,681,538 L42H probably damaging Het
Svs3a A T 2: 164,290,013 D168V probably damaging Het
Themis T A 10: 28,761,426 Y175* probably null Het
Tspan33 G T 6: 29,716,784 R180L probably benign Het
Ttc28 C T 5: 111,085,092 S145F probably damaging Het
Txn2 G A 15: 77,926,678 T102I unknown Het
Usp34 T A 11: 23,426,183 V1908E Het
Vmn2r101 A G 17: 19,589,088 I160V probably null Het
Vmn2r104 A T 17: 20,030,096 C638S possibly damaging Het
Wdfy4 C T 14: 32,960,820 R3136Q Het
Zan C A 5: 137,398,290 A4335S unknown Het
Zfp180 G T 7: 24,104,533 V126F probably benign Het
Zfp429 T A 13: 67,390,812 D171V possibly damaging Het
Zfp638 T C 6: 83,954,726 I798T probably benign Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R2331:Olfr1216 UTSW 2 89013921 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
R8243:Olfr1216 UTSW 2 89013707 missense probably benign 0.39
R8752:Olfr1216 UTSW 2 89013887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGAGATGGTCTTCTTCTCATG -3'
(R):5'- CCTCAATGCAAATGTATCTATTCGC -3'

Sequencing Primer
(F):5'- GTAAGAAGTCTACAACCATCTTGGG -3'
(R):5'- TGCAAATGTATCTATTCGCATAAGG -3'
Posted On2019-05-15