Incidental Mutation 'R7101:Prr14l'
ID 550806
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms Prl14l, 6030436E02Rik, C330019G07Rik
MMRRC Submission 045193-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R7101 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32947164-33011600 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32986771 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 908 (L908P)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: L908P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: L908P

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155392
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A G 8: 41,208,438 (GRCm39) D568G probably benign Het
Angpt1 T C 15: 42,386,965 (GRCm39) I130V probably benign Het
Ankrd11 G T 8: 123,622,194 (GRCm39) Q553K probably benign Het
Ankrd42 A T 7: 92,280,752 (GRCm39) H59Q possibly damaging Het
Ankrd52 C T 10: 128,218,249 (GRCm39) R318C probably damaging Het
Arrdc5 G A 17: 56,601,522 (GRCm39) T201M probably damaging Het
Atxn1l A G 8: 110,459,132 (GRCm39) S377P probably benign Het
Baz2a T C 10: 127,957,056 (GRCm39) F936S possibly damaging Het
Bicc1 T C 10: 70,766,483 (GRCm39) D913G probably damaging Het
Blnk T A 19: 40,961,082 (GRCm39) M21L probably benign Het
Cabin1 T C 10: 75,587,401 (GRCm39) H132R probably benign Het
Ccdc154 A G 17: 25,382,442 (GRCm39) H88R probably benign Het
Cfap20dc G T 14: 8,511,171 (GRCm38) S414R possibly damaging Het
Clic5 G T 17: 44,586,179 (GRCm39) A223S probably benign Het
Col28a1 T A 6: 8,014,795 (GRCm39) Y870F possibly damaging Het
Dhx37 G A 5: 125,502,006 (GRCm39) Q497* probably null Het
Dnah11 T C 12: 118,031,880 (GRCm39) T1763A probably benign Het
Dnajc13 T C 9: 104,042,221 (GRCm39) R2005G possibly damaging Het
Dop1a G A 9: 86,389,722 (GRCm39) G541S probably benign Het
Drosha C T 15: 12,865,153 (GRCm39) T627M probably damaging Het
Ephb3 C T 16: 21,037,268 (GRCm39) H455Y possibly damaging Het
Eri1 A C 8: 35,949,777 (GRCm39) C127G probably damaging Het
Faf1 A T 4: 109,783,153 (GRCm39) E548D probably benign Het
Gm3285 C A 10: 77,698,194 (GRCm39) C114* probably null Het
Gm9736 C T 10: 77,587,167 (GRCm39) V8I unknown Het
Gnptab A T 10: 88,276,174 (GRCm39) M1154L probably benign Het
Grin1 G A 2: 25,186,647 (GRCm39) T770M probably damaging Het
Haus1 A G 18: 77,854,570 (GRCm39) S67P possibly damaging Het
Homer1 C A 13: 93,492,562 (GRCm39) Q184K probably benign Het
Hook2 A G 8: 85,723,680 (GRCm39) T401A probably benign Het
Il6st G A 13: 112,631,907 (GRCm39) probably null Het
Kcnh8 A T 17: 53,212,038 (GRCm39) D612V probably damaging Het
Ltbr C G 6: 125,289,763 (GRCm39) E144Q probably benign Het
Mcf2l G T 8: 13,063,579 (GRCm39) R961L possibly damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,214,363 (GRCm39) probably null Het
Myo1b G T 1: 51,797,160 (GRCm39) Q961K probably benign Het
Myo1h C A 5: 114,480,258 (GRCm39) T531N Het
Ngly1 G A 14: 16,283,445 (GRCm38) R408Q probably damaging Het
Nup133 T C 8: 124,632,966 (GRCm39) E1055G possibly damaging Het
Nutm2 A G 13: 50,626,934 (GRCm39) K363R probably benign Het
Obox8 A T 7: 14,066,752 (GRCm39) Y97* probably null Het
Odc1 A G 12: 17,597,319 (GRCm39) D7G probably benign Het
Ogfod2 C T 5: 124,252,558 (GRCm39) T182I unknown Het
Or2t49 A G 11: 58,393,379 (GRCm39) M7T probably benign Het
Or4c111 A T 2: 88,844,324 (GRCm39) V28E possibly damaging Het
Or8b12b T C 9: 37,684,287 (GRCm39) S111P probably damaging Het
Or8b46 G A 9: 38,450,966 (GRCm39) M258I probably benign Het
Parp4 A G 14: 56,827,430 (GRCm39) D188G probably benign Het
Phactr2 T C 10: 13,122,922 (GRCm39) E400G probably benign Het
Phlpp1 G A 1: 106,100,397 (GRCm39) V222M possibly damaging Het
Ppp1r16b T C 2: 158,603,683 (GRCm39) V536A probably damaging Het
Prex2 T C 1: 11,223,833 (GRCm39) V719A possibly damaging Het
Prpf8 C T 11: 75,381,226 (GRCm39) A242V possibly damaging Het
Prrc2b A G 2: 32,117,005 (GRCm39) N2146D possibly damaging Het
Rtkn T C 6: 83,126,993 (GRCm39) V333A possibly damaging Het
Samd8 T C 14: 21,825,442 (GRCm39) Y196H probably benign Het
Six5 A G 7: 18,828,784 (GRCm39) T75A probably benign Het
Slc35a4 T A 18: 36,814,591 (GRCm39) L42H probably damaging Het
Svs3a A T 2: 164,131,933 (GRCm39) D168V probably damaging Het
Themis T A 10: 28,637,422 (GRCm39) Y175* probably null Het
Tspan33 G T 6: 29,716,783 (GRCm39) R180L probably benign Het
Ttc28 C T 5: 111,232,958 (GRCm39) S145F probably damaging Het
Txn2 G A 15: 77,810,878 (GRCm39) T102I unknown Het
Usp34 T A 11: 23,376,183 (GRCm39) V1908E Het
Vmn2r101 A G 17: 19,809,350 (GRCm39) I160V probably null Het
Vmn2r104 A T 17: 20,250,358 (GRCm39) C638S possibly damaging Het
Wdfy4 C T 14: 32,682,777 (GRCm39) R3136Q Het
Zan C A 5: 137,396,552 (GRCm39) A4335S unknown Het
Zfp180 G T 7: 23,803,958 (GRCm39) V126F probably benign Het
Zfp429 T A 13: 67,538,931 (GRCm39) D171V possibly damaging Het
Zfp638 T C 6: 83,931,708 (GRCm39) I798T probably benign Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32,988,020 (GRCm39) missense probably benign 0.04
IGL00331:Prr14l APN 5 32,988,410 (GRCm39) missense probably benign 0.02
IGL01571:Prr14l APN 5 32,986,150 (GRCm39) missense probably benign 0.01
IGL01795:Prr14l APN 5 32,989,189 (GRCm39) unclassified probably benign
IGL01929:Prr14l APN 5 32,985,587 (GRCm39) missense probably benign 0.09
IGL01959:Prr14l APN 5 32,987,549 (GRCm39) missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32,984,876 (GRCm39) missense probably damaging 1.00
IGL02321:Prr14l APN 5 32,985,151 (GRCm39) missense probably benign 0.10
IGL02508:Prr14l APN 5 32,988,286 (GRCm39) missense probably benign 0.01
IGL02551:Prr14l APN 5 32,988,828 (GRCm39) missense probably damaging 1.00
IGL02585:Prr14l APN 5 32,986,828 (GRCm39) missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32,987,887 (GRCm39) missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32,985,526 (GRCm39) missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32,988,440 (GRCm39) missense probably benign 0.42
IGL02952:Prr14l APN 5 32,993,014 (GRCm39) missense unknown
IGL03034:Prr14l APN 5 32,984,782 (GRCm39) missense possibly damaging 0.48
Polymer UTSW 5 32,984,489 (GRCm39) missense probably benign 0.34
Postwar UTSW 5 32,988,028 (GRCm39) missense probably benign 0.17
H8562:Prr14l UTSW 5 32,951,072 (GRCm39) missense probably damaging 1.00
R0086:Prr14l UTSW 5 32,988,903 (GRCm39) unclassified probably benign
R0149:Prr14l UTSW 5 32,950,985 (GRCm39) missense probably damaging 1.00
R0333:Prr14l UTSW 5 32,985,337 (GRCm39) missense probably damaging 1.00
R0361:Prr14l UTSW 5 32,950,985 (GRCm39) missense probably damaging 1.00
R0416:Prr14l UTSW 5 32,986,061 (GRCm39) missense probably benign 0.25
R0480:Prr14l UTSW 5 32,987,224 (GRCm39) missense probably benign 0.02
R0511:Prr14l UTSW 5 33,001,560 (GRCm39) intron probably benign
R0639:Prr14l UTSW 5 32,986,259 (GRCm39) missense probably benign 0.02
R0673:Prr14l UTSW 5 32,986,259 (GRCm39) missense probably benign 0.02
R0743:Prr14l UTSW 5 32,988,538 (GRCm39) missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32,985,767 (GRCm39) missense probably damaging 1.00
R1006:Prr14l UTSW 5 32,986,826 (GRCm39) missense probably benign 0.00
R1342:Prr14l UTSW 5 32,987,604 (GRCm39) missense probably damaging 1.00
R1433:Prr14l UTSW 5 32,986,177 (GRCm39) missense probably damaging 1.00
R1527:Prr14l UTSW 5 32,985,293 (GRCm39) missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32,987,626 (GRCm39) missense probably benign 0.01
R1967:Prr14l UTSW 5 33,001,813 (GRCm39) intron probably benign
R2129:Prr14l UTSW 5 32,989,172 (GRCm39) unclassified probably benign
R2150:Prr14l UTSW 5 32,988,046 (GRCm39) missense probably benign 0.14
R2318:Prr14l UTSW 5 32,987,422 (GRCm39) missense probably benign 0.04
R2915:Prr14l UTSW 5 32,987,112 (GRCm39) missense probably benign 0.04
R3551:Prr14l UTSW 5 32,985,963 (GRCm39) splice site probably null
R3820:Prr14l UTSW 5 32,986,328 (GRCm39) missense probably damaging 0.99
R3852:Prr14l UTSW 5 32,987,689 (GRCm39) missense probably damaging 1.00
R4126:Prr14l UTSW 5 32,985,347 (GRCm39) missense probably damaging 0.97
R4345:Prr14l UTSW 5 32,985,920 (GRCm39) missense probably damaging 1.00
R4388:Prr14l UTSW 5 32,986,598 (GRCm39) missense probably damaging 1.00
R4575:Prr14l UTSW 5 32,950,988 (GRCm39) missense probably damaging 1.00
R4596:Prr14l UTSW 5 32,986,652 (GRCm39) missense probably benign 0.01
R4690:Prr14l UTSW 5 33,001,500 (GRCm39) intron probably benign
R4824:Prr14l UTSW 5 33,001,743 (GRCm39) intron probably benign
R4868:Prr14l UTSW 5 32,987,281 (GRCm39) missense probably benign 0.04
R4869:Prr14l UTSW 5 32,986,177 (GRCm39) missense probably damaging 1.00
R5201:Prr14l UTSW 5 32,987,591 (GRCm39) missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32,987,365 (GRCm39) missense probably benign 0.00
R5410:Prr14l UTSW 5 32,985,121 (GRCm39) missense probably damaging 0.98
R5476:Prr14l UTSW 5 33,001,482 (GRCm39) intron probably benign
R5623:Prr14l UTSW 5 33,001,852 (GRCm39) intron probably benign
R5730:Prr14l UTSW 5 32,950,947 (GRCm39) missense probably damaging 1.00
R5988:Prr14l UTSW 5 32,988,195 (GRCm39) missense probably damaging 0.98
R6261:Prr14l UTSW 5 32,986,748 (GRCm39) missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32,987,608 (GRCm39) missense probably benign 0.14
R6307:Prr14l UTSW 5 32,984,869 (GRCm39) missense probably damaging 0.97
R6825:Prr14l UTSW 5 32,985,892 (GRCm39) missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32,985,103 (GRCm39) missense probably damaging 1.00
R6880:Prr14l UTSW 5 32,988,211 (GRCm39) missense probably benign 0.01
R6931:Prr14l UTSW 5 32,988,035 (GRCm39) missense probably damaging 0.98
R7164:Prr14l UTSW 5 32,986,510 (GRCm39) missense probably damaging 1.00
R7203:Prr14l UTSW 5 32,984,489 (GRCm39) missense probably benign 0.34
R7211:Prr14l UTSW 5 32,987,431 (GRCm39) missense probably damaging 0.98
R7305:Prr14l UTSW 5 32,988,445 (GRCm39) missense probably benign 0.14
R7346:Prr14l UTSW 5 32,988,028 (GRCm39) missense probably benign 0.17
R7395:Prr14l UTSW 5 32,985,982 (GRCm39) missense probably benign 0.00
R7624:Prr14l UTSW 5 32,986,967 (GRCm39) missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32,985,589 (GRCm39) missense probably benign 0.18
R7753:Prr14l UTSW 5 32,984,597 (GRCm39) missense probably damaging 1.00
R7828:Prr14l UTSW 5 33,001,735 (GRCm39) intron probably benign
R7898:Prr14l UTSW 5 32,987,310 (GRCm39) missense probably benign 0.04
R8071:Prr14l UTSW 5 32,988,508 (GRCm39) missense probably benign 0.02
R9052:Prr14l UTSW 5 32,987,478 (GRCm39) nonsense probably null
R9136:Prr14l UTSW 5 32,986,080 (GRCm39) missense
R9682:Prr14l UTSW 5 32,988,023 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGTCTGGACAGTCTTCCATTTC -3'
(R):5'- GATCTGACAGTCAGCTCAGG -3'

Sequencing Primer
(F):5'- TGGACAGTCTTCCATTTCATAGTC -3'
(R):5'- TCAGGCAGTAAAGTCCCTCTG -3'
Posted On 2019-05-15