Incidental Mutation 'R7101:Zan'
ID550811
Institutional Source Beutler Lab
Gene Symbol Zan
Ensembl Gene ENSMUSG00000079173
Gene Namezonadhesin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7101 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location137378637-137477064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 137398290 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 4335 (A4335S)
Ref Sequence ENSEMBL: ENSMUSP00000114068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117564] [ENSMUST00000164178]
Predicted Effect unknown
Transcript: ENSMUST00000117564
AA Change: A4335S
SMART Domains Protein: ENSMUSP00000114068
Gene: ENSMUSG00000079173
AA Change: A4335S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 4.5e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 3e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 1.9e-12 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164178
AA Change: A4335S
SMART Domains Protein: ENSMUSP00000132895
Gene: ENSMUSG00000079173
AA Change: A4335S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MAM 42 210 3.55e-20 SMART
MAM 214 374 3.97e-9 SMART
MAM 375 542 5.7e-42 SMART
low complexity region 549 563 N/A INTRINSIC
low complexity region 578 607 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
low complexity region 672 689 N/A INTRINSIC
low complexity region 702 779 N/A INTRINSIC
low complexity region 782 865 N/A INTRINSIC
low complexity region 890 913 N/A INTRINSIC
low complexity region 941 1038 N/A INTRINSIC
low complexity region 1043 1084 N/A INTRINSIC
low complexity region 1096 1131 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
EGF_like 1236 1259 7.09e1 SMART
VWC 1266 1356 5e-3 SMART
VWD 1316 1477 3.73e-36 SMART
C8 1521 1596 6.91e-23 SMART
EGF_like 1607 1647 6.41e1 SMART
VWC 1654 1745 1.08e-2 SMART
VWD 1703 1869 2.71e-47 SMART
C8 1908 1982 3.45e-32 SMART
Pfam:TIL 1985 2039 2.3e-13 PFAM
VWC 2041 2095 4.84e-1 SMART
FOLN 2074 2096 9.79e1 SMART
VWD 2088 2260 5.49e-25 SMART
C8 2307 2381 6.73e-3 SMART
Pfam:TIL 2384 2442 6e-12 PFAM
VWC 2444 2504 1.13e-1 SMART
FOLN 2475 2498 3.73e0 SMART
EGF_like 2512 2557 6.54e1 SMART
VWC 2564 2637 3.68e-2 SMART
FOLN 2595 2618 4.04e0 SMART
VWC 2684 2744 3.08e-1 SMART
FOLN 2715 2738 7.78e0 SMART
VWC 2804 2864 1.7e0 SMART
FOLN 2835 2858 2.58e1 SMART
VWC 2924 2984 4.74e-1 SMART
VWC 3044 3104 2.44e-1 SMART
VWC 3164 3237 7.57e-2 SMART
FOLN 3195 3218 2.25e1 SMART
VWC 3284 3344 4.22e-1 SMART
FOLN 3315 3338 2.1e0 SMART
VWC 3401 3461 7.67e-2 SMART
FOLN 3432 3455 4.39e0 SMART
VWC 3521 3581 8.45e-2 SMART
FOLN 3552 3575 1.27e1 SMART
VWC 3641 3714 3.51e-1 SMART
FOLN 3672 3695 2.16e0 SMART
VWC 3761 3821 9.7e-2 SMART
FOLN 3792 3815 1.27e1 SMART
VWC 3881 3954 1.83e-1 SMART
FOLN 3912 3933 1.17e1 SMART
VWC 3997 4050 3.61e-1 SMART
FOLN 4028 4051 1.84e0 SMART
EGF_like 4081 4126 5.79e1 SMART
VWC 4133 4210 4.03e-1 SMART
FOLN 4164 4187 7.99e0 SMART
VWC 4253 4308 3.21e-1 SMART
FOLN 4284 4302 8.54e1 SMART
VWC 4368 4428 2.74e-2 SMART
FOLN 4399 4422 7.46e1 SMART
VWC 4488 4548 6.37e-1 SMART
FOLN 4519 4542 1.04e0 SMART
VWC 4608 4681 4.47e-1 SMART
FOLN 4639 4662 2.22e0 SMART
VWC 4728 4781 1.12e0 SMART
FOLN 4759 4782 3.29e1 SMART
EGF 4800 4841 2.43e1 SMART
VWC 4848 4901 7.59e-1 SMART
FOLN 4879 4902 5.31e0 SMART
VWD 4899 5061 4.49e-30 SMART
low complexity region 5086 5102 N/A INTRINSIC
C8 5113 5191 8.25e-21 SMART
Pfam:TIL 5194 5247 7.2e-13 PFAM
VWC 5249 5307 1.22e0 SMART
EGF 5306 5339 3.15e-3 SMART
transmembrane domain 5356 5378 N/A INTRINSIC
low complexity region 5381 5399 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the species specificity of sperm adhesion to the egg zona pellucida. The encoded protein is located in the acrosome and may be involved in signaling or gamete recognition. An allelic polymorphism in this gene results in both functional and frameshifted alleles; the reference genome represents the functional allele. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Sperm from mice homozygous for a knock-out allele exhibit decreased species-specific zona pellucida adhesion without alteration in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,511,171 S414R possibly damaging Het
Adam25 A G 8: 40,755,401 D568G probably benign Het
Angpt1 T C 15: 42,523,569 I130V probably benign Het
Ankrd11 G T 8: 122,895,455 Q553K probably benign Het
Ankrd42 A T 7: 92,631,544 H59Q possibly damaging Het
Ankrd52 C T 10: 128,382,380 R318C probably damaging Het
Arrdc5 G A 17: 56,294,522 T201M probably damaging Het
Atxn1l A G 8: 109,732,500 S377P probably benign Het
Baz2a T C 10: 128,121,187 F936S possibly damaging Het
Bicc1 T C 10: 70,930,653 D913G probably damaging Het
Blnk T A 19: 40,972,638 M21L probably benign Het
Cabin1 T C 10: 75,751,567 H132R probably benign Het
Ccdc154 A G 17: 25,163,468 H88R probably benign Het
Clic5 G T 17: 44,275,292 A223S probably benign Het
Col28a1 T A 6: 8,014,795 Y870F possibly damaging Het
Dhx37 G A 5: 125,424,942 Q497* probably null Het
Dnah11 T C 12: 118,068,145 T1763A probably benign Het
Dnajc13 T C 9: 104,165,022 R2005G possibly damaging Het
Dopey1 G A 9: 86,507,669 G541S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Ephb3 C T 16: 21,218,518 H455Y possibly damaging Het
Eri1 A C 8: 35,482,623 C127G probably damaging Het
Faf1 A T 4: 109,925,956 E548D probably benign Het
Gm3285 C A 10: 77,862,360 C114* probably null Het
Gm9736 C T 10: 77,751,333 V8I unknown Het
Gnptab A T 10: 88,440,312 M1154L probably benign Het
Grin1 G A 2: 25,296,635 T770M probably damaging Het
Haus1 A G 18: 77,766,870 S67P possibly damaging Het
Homer1 C A 13: 93,356,054 Q184K probably benign Het
Hook2 A G 8: 84,997,051 T401A probably benign Het
Il6st G A 13: 112,495,373 probably null Het
Kcnh8 A T 17: 52,905,010 D612V probably damaging Het
Ltbr C G 6: 125,312,800 E144Q probably benign Het
Mcf2l G T 8: 13,013,579 R961L possibly damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1b G T 1: 51,758,001 Q961K probably benign Het
Myo1h C A 5: 114,342,197 T531N Het
Ngly1 G A 14: 16,283,445 R408Q probably damaging Het
Nup133 T C 8: 123,906,227 E1055G possibly damaging Het
Nutm2 A G 13: 50,472,898 K363R probably benign Het
Obox8 A T 7: 14,332,827 Y97* probably null Het
Odc1 A G 12: 17,547,318 D7G probably benign Het
Ogfod2 C T 5: 124,114,495 T182I unknown Het
Olfr1216 A T 2: 89,013,980 V28E possibly damaging Het
Olfr331 A G 11: 58,502,553 M7T probably benign Het
Olfr875 T C 9: 37,772,991 S111P probably damaging Het
Olfr910 G A 9: 38,539,670 M258I probably benign Het
Parp4 A G 14: 56,589,973 D188G probably benign Het
Phactr2 T C 10: 13,247,178 E400G probably benign Het
Phlpp1 G A 1: 106,172,667 V222M possibly damaging Het
Ppp1r16b T C 2: 158,761,763 V536A probably damaging Het
Prex2 T C 1: 11,153,609 V719A possibly damaging Het
Prpf8 C T 11: 75,490,400 A242V possibly damaging Het
Prr14l A G 5: 32,829,427 L908P probably damaging Het
Prrc2b A G 2: 32,226,993 N2146D possibly damaging Het
Rtkn T C 6: 83,150,012 V333A possibly damaging Het
Samd8 T C 14: 21,775,374 Y196H probably benign Het
Six5 A G 7: 19,094,859 T75A probably benign Het
Slc35a4 T A 18: 36,681,538 L42H probably damaging Het
Svs3a A T 2: 164,290,013 D168V probably damaging Het
Themis T A 10: 28,761,426 Y175* probably null Het
Tspan33 G T 6: 29,716,784 R180L probably benign Het
Ttc28 C T 5: 111,085,092 S145F probably damaging Het
Txn2 G A 15: 77,926,678 T102I unknown Het
Usp34 T A 11: 23,426,183 V1908E Het
Vmn2r101 A G 17: 19,589,088 I160V probably null Het
Vmn2r104 A T 17: 20,030,096 C638S possibly damaging Het
Wdfy4 C T 14: 32,960,820 R3136Q Het
Zfp180 G T 7: 24,104,533 V126F probably benign Het
Zfp429 T A 13: 67,390,812 D171V possibly damaging Het
Zfp638 T C 6: 83,954,726 I798T probably benign Het
Other mutations in Zan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zan APN 5 137387820 critical splice donor site probably null
IGL00158:Zan APN 5 137454257 missense unknown
IGL00473:Zan APN 5 137464250 missense possibly damaging 0.68
IGL00536:Zan APN 5 137446682 missense unknown
IGL00567:Zan APN 5 137416277 unclassified probably benign
IGL00820:Zan APN 5 137386364 missense unknown
IGL00850:Zan APN 5 137464113 missense unknown
IGL00906:Zan APN 5 137389360 missense unknown
IGL00920:Zan APN 5 137464524 missense unknown
IGL00964:Zan APN 5 137405941 unclassified probably benign
IGL01356:Zan APN 5 137436432 missense unknown
IGL01361:Zan APN 5 137414342 unclassified probably benign
IGL01362:Zan APN 5 137452450 missense unknown
IGL01411:Zan APN 5 137388893 missense unknown
IGL01412:Zan APN 5 137393032 missense unknown
IGL01531:Zan APN 5 137424612 missense unknown
IGL01561:Zan APN 5 137463866 missense unknown
IGL01564:Zan APN 5 137446733 missense unknown
IGL01568:Zan APN 5 137464844 missense unknown
IGL01719:Zan APN 5 137395654 missense unknown
IGL01732:Zan APN 5 137393011 missense unknown
IGL01761:Zan APN 5 137425597 missense unknown
IGL01771:Zan APN 5 137393068 missense unknown
IGL01810:Zan APN 5 137463626 missense unknown
IGL01845:Zan APN 5 137380854 unclassified probably benign
IGL01885:Zan APN 5 137464124 missense unknown
IGL01992:Zan APN 5 137424106 missense unknown
IGL02026:Zan APN 5 137405464 unclassified probably benign
IGL02065:Zan APN 5 137386960 nonsense probably null
IGL02133:Zan APN 5 137411498 missense possibly damaging 0.84
IGL02274:Zan APN 5 137421167 missense unknown
IGL02449:Zan APN 5 137389327 missense unknown
IGL02456:Zan APN 5 137446844 missense unknown
IGL02493:Zan APN 5 137435706 missense unknown
IGL02496:Zan APN 5 137464794 nonsense probably null
IGL02528:Zan APN 5 137465141 missense possibly damaging 0.83
IGL02550:Zan APN 5 137387039 missense unknown
IGL02598:Zan APN 5 137446211 missense unknown
IGL02697:Zan APN 5 137400548 missense unknown
IGL02933:Zan APN 5 137428414 missense unknown
IGL02963:Zan APN 5 137456250 missense unknown
IGL02972:Zan APN 5 137463686 missense unknown
IGL03068:Zan APN 5 137476415 missense probably damaging 1.00
IGL03104:Zan APN 5 137463500 missense unknown
IGL03110:Zan APN 5 137420016 missense unknown
IGL03156:Zan APN 5 137463939 missense unknown
IGL03302:Zan APN 5 137468390 missense possibly damaging 0.93
IGL03307:Zan APN 5 137474025 missense probably damaging 0.99
IGL03340:Zan APN 5 137427874 missense unknown
IGL03379:Zan APN 5 137464215 missense unknown
IGL03405:Zan APN 5 137424597 missense unknown
Befallen UTSW 5 137412676 unclassified probably benign
befell UTSW 5 137446037 intron probably null
PIT4283001:Zan UTSW 5 137400093 missense unknown
PIT4431001:Zan UTSW 5 137392064 missense unknown
PIT4498001:Zan UTSW 5 137417036 critical splice donor site probably null
R0027:Zan UTSW 5 137406519 unclassified probably benign
R0047:Zan UTSW 5 137403656 missense unknown
R0149:Zan UTSW 5 137396766 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0240:Zan UTSW 5 137398362 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0241:Zan UTSW 5 137421822 missense unknown
R0361:Zan UTSW 5 137396766 missense unknown
R0432:Zan UTSW 5 137382316 unclassified probably benign
R0436:Zan UTSW 5 137464902 missense unknown
R0446:Zan UTSW 5 137391658 missense unknown
R0457:Zan UTSW 5 137407706 unclassified probably benign
R0478:Zan UTSW 5 137400526 splice site probably benign
R0487:Zan UTSW 5 137413358 critical splice donor site probably null
R0497:Zan UTSW 5 137412676 unclassified probably benign
R0504:Zan UTSW 5 137470318 missense probably damaging 1.00
R0545:Zan UTSW 5 137396177 missense unknown
R0556:Zan UTSW 5 137454220 missense unknown
R0615:Zan UTSW 5 137468431 missense probably damaging 1.00
R0737:Zan UTSW 5 137389249 missense unknown
R0835:Zan UTSW 5 137408397 unclassified probably benign
R0863:Zan UTSW 5 137458639 missense unknown
R0971:Zan UTSW 5 137434063 missense unknown
R1327:Zan UTSW 5 137465911 splice site probably benign
R1338:Zan UTSW 5 137393651 nonsense probably null
R1413:Zan UTSW 5 137427939 missense unknown
R1446:Zan UTSW 5 137389360 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1464:Zan UTSW 5 137419929 missense unknown
R1561:Zan UTSW 5 137380838 nonsense probably null
R1569:Zan UTSW 5 137429130 missense unknown
R1575:Zan UTSW 5 137461952 missense unknown
R1618:Zan UTSW 5 137383830 missense unknown
R1634:Zan UTSW 5 137412790 unclassified probably benign
R1650:Zan UTSW 5 137394601 splice site probably benign
R1680:Zan UTSW 5 137403050 missense unknown
R1698:Zan UTSW 5 137409669 utr 3 prime probably benign
R1704:Zan UTSW 5 137434002 nonsense probably null
R1728:Zan UTSW 5 137415018 unclassified probably benign
R1729:Zan UTSW 5 137415018 unclassified probably benign
R1769:Zan UTSW 5 137464518 missense unknown
R1774:Zan UTSW 5 137419989 missense unknown
R1800:Zan UTSW 5 137386451 missense unknown
R1858:Zan UTSW 5 137405877 unclassified probably benign
R1888:Zan UTSW 5 137389328 missense unknown
R1888:Zan UTSW 5 137389328 missense unknown
R1925:Zan UTSW 5 137425642 missense unknown
R1938:Zan UTSW 5 137388939 missense unknown
R1955:Zan UTSW 5 137389283 missense unknown
R1989:Zan UTSW 5 137420006 nonsense probably null
R1997:Zan UTSW 5 137403114 nonsense probably null
R2008:Zan UTSW 5 137452450 missense unknown
R2035:Zan UTSW 5 137443947 missense unknown
R2153:Zan UTSW 5 137436400 missense unknown
R2154:Zan UTSW 5 137414249 unclassified probably benign
R2176:Zan UTSW 5 137421848 missense unknown
R2217:Zan UTSW 5 137410306 utr 3 prime probably benign
R2218:Zan UTSW 5 137410306 utr 3 prime probably benign
R2237:Zan UTSW 5 137457837 nonsense probably null
R2239:Zan UTSW 5 137457837 nonsense probably null
R2346:Zan UTSW 5 137421867 missense unknown
R2360:Zan UTSW 5 137396126 missense unknown
R2389:Zan UTSW 5 137476380 critical splice donor site probably null
R2412:Zan UTSW 5 137414163 splice site probably null
R2426:Zan UTSW 5 137388992 missense unknown
R2435:Zan UTSW 5 137438574 missense unknown
R2509:Zan UTSW 5 137456586 missense unknown
R3416:Zan UTSW 5 137435720 missense unknown
R3691:Zan UTSW 5 137420019 missense unknown
R3853:Zan UTSW 5 137474064 missense probably damaging 1.00
R4006:Zan UTSW 5 137463939 missense unknown
R4007:Zan UTSW 5 137463939 missense unknown
R4033:Zan UTSW 5 137437860 nonsense probably null
R4059:Zan UTSW 5 137436820 missense unknown
R4109:Zan UTSW 5 137458619 missense unknown
R4194:Zan UTSW 5 137463555 missense unknown
R4226:Zan UTSW 5 137423978 missense unknown
R4457:Zan UTSW 5 137411516 missense unknown
R4544:Zan UTSW 5 137383834 missense unknown
R4546:Zan UTSW 5 137383834 missense unknown
R4642:Zan UTSW 5 137464188 missense unknown
R4708:Zan UTSW 5 137446712 missense unknown
R4773:Zan UTSW 5 137436313 splice site probably benign
R4774:Zan UTSW 5 137389019 missense unknown
R4788:Zan UTSW 5 137442113 missense unknown
R4795:Zan UTSW 5 137380850 nonsense probably null
R4796:Zan UTSW 5 137380850 nonsense probably null
R4812:Zan UTSW 5 137456285 missense unknown
R4832:Zan UTSW 5 137393161 missense unknown
R4882:Zan UTSW 5 137438448 missense unknown
R4896:Zan UTSW 5 137386456 missense unknown
R4921:Zan UTSW 5 137408370 unclassified probably benign
R4943:Zan UTSW 5 137457890 missense unknown
R4978:Zan UTSW 5 137406921 unclassified probably benign
R5013:Zan UTSW 5 137383837 missense unknown
R5024:Zan UTSW 5 137461893 nonsense probably null
R5230:Zan UTSW 5 137454078 missense unknown
R5354:Zan UTSW 5 137380788 unclassified probably benign
R5380:Zan UTSW 5 137457840 missense unknown
R5394:Zan UTSW 5 137435634 missense unknown
R5394:Zan UTSW 5 137464074 missense unknown
R5435:Zan UTSW 5 137403762 missense unknown
R5441:Zan UTSW 5 137436751 missense unknown
R5447:Zan UTSW 5 137472191 missense probably damaging 1.00
R5455:Zan UTSW 5 137454000 missense unknown
R5495:Zan UTSW 5 137470408 missense probably damaging 1.00
R5496:Zan UTSW 5 137436345 missense unknown
R5523:Zan UTSW 5 137421893 missense unknown
R5534:Zan UTSW 5 137438451 missense unknown
R5572:Zan UTSW 5 137394431 missense unknown
R5576:Zan UTSW 5 137428482 nonsense probably null
R5587:Zan UTSW 5 137391762 missense unknown
R5593:Zan UTSW 5 137468338 missense possibly damaging 0.72
R5600:Zan UTSW 5 137386971 missense unknown
R5682:Zan UTSW 5 137414259 nonsense probably null
R5712:Zan UTSW 5 137400098 missense unknown
R5751:Zan UTSW 5 137410161 intron probably null
R5782:Zan UTSW 5 137420007 missense unknown
R5835:Zan UTSW 5 137456655 missense unknown
R5846:Zan UTSW 5 137394376 splice site probably null
R5903:Zan UTSW 5 137442134 missense unknown
R5911:Zan UTSW 5 137457912 missense unknown
R5935:Zan UTSW 5 137443930 missense unknown
R5985:Zan UTSW 5 137446037 intron probably null
R5995:Zan UTSW 5 137378809 unclassified probably benign
R6012:Zan UTSW 5 137464529 missense unknown
R6077:Zan UTSW 5 137414297 unclassified probably benign
R6227:Zan UTSW 5 137468343 missense probably damaging 0.96
R6262:Zan UTSW 5 137429485 intron probably null
R6337:Zan UTSW 5 137452488 missense unknown
R6598:Zan UTSW 5 137406364 unclassified probably benign
R6725:Zan UTSW 5 137438520 missense unknown
R6765:Zan UTSW 5 137393147 missense unknown
R6820:Zan UTSW 5 137407844 unclassified probably benign
R6829:Zan UTSW 5 137416278 unclassified probably benign
R6851:Zan UTSW 5 137396191 missense unknown
R6903:Zan UTSW 5 137456304 missense unknown
R6910:Zan UTSW 5 137419080 missense unknown
R6968:Zan UTSW 5 137461813 missense unknown
R7021:Zan UTSW 5 137423951 missense unknown
R7039:Zan UTSW 5 137400134 missense unknown
R7102:Zan UTSW 5 137454200 critical splice donor site probably null
R7155:Zan UTSW 5 137461844 missense unknown
R7158:Zan UTSW 5 137400644 missense unknown
R7170:Zan UTSW 5 137463494 missense unknown
R7203:Zan UTSW 5 137434096 missense unknown
R7204:Zan UTSW 5 137427978 missense unknown
R7305:Zan UTSW 5 137415139 missense unknown
R7327:Zan UTSW 5 137465232 missense probably benign 0.35
R7340:Zan UTSW 5 137383830 missense unknown
R7360:Zan UTSW 5 137386970 missense unknown
R7385:Zan UTSW 5 137434154 nonsense probably null
R7385:Zan UTSW 5 137450491 missense unknown
R7438:Zan UTSW 5 137425562 missense unknown
R7453:Zan UTSW 5 137466002 missense probably damaging 1.00
R7483:Zan UTSW 5 137446795 missense unknown
R7499:Zan UTSW 5 137464356 missense probably benign 0.23
R7566:Zan UTSW 5 137412583 critical splice donor site probably null
R7641:Zan UTSW 5 137467108 missense possibly damaging 0.74
R7674:Zan UTSW 5 137467108 missense possibly damaging 0.74
R7678:Zan UTSW 5 137463540 missense unknown
R7785:Zan UTSW 5 137429143 missense unknown
R7814:Zan UTSW 5 137463579 missense unknown
RF013:Zan UTSW 5 137391720 missense unknown
X0062:Zan UTSW 5 137446238 missense unknown
X0066:Zan UTSW 5 137464430 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCTTCCTGCAAACAGC -3'
(R):5'- CCAAATTGGTTTCTGCAGCC -3'

Sequencing Primer
(F):5'- TGAAGCAGCTCCTCACTCACTG -3'
(R):5'- AAATTGGTTTCTGCAGCCTCTGTG -3'
Posted On2019-05-15