Incidental Mutation 'R7101:Bicc1'
ID550835
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7101 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70930653 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 913 (D913G)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: D913G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: D913G

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: D831G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: D831G

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: D913G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: D913G

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,511,171 S414R possibly damaging Het
Adam25 A G 8: 40,755,401 D568G probably benign Het
Angpt1 T C 15: 42,523,569 I130V probably benign Het
Ankrd11 G T 8: 122,895,455 Q553K probably benign Het
Ankrd42 A T 7: 92,631,544 H59Q possibly damaging Het
Ankrd52 C T 10: 128,382,380 R318C probably damaging Het
Arrdc5 G A 17: 56,294,522 T201M probably damaging Het
Atxn1l A G 8: 109,732,500 S377P probably benign Het
Baz2a T C 10: 128,121,187 F936S possibly damaging Het
Blnk T A 19: 40,972,638 M21L probably benign Het
Cabin1 T C 10: 75,751,567 H132R probably benign Het
Ccdc154 A G 17: 25,163,468 H88R probably benign Het
Clic5 G T 17: 44,275,292 A223S probably benign Het
Col28a1 T A 6: 8,014,795 Y870F possibly damaging Het
Dhx37 G A 5: 125,424,942 Q497* probably null Het
Dnah11 T C 12: 118,068,145 T1763A probably benign Het
Dnajc13 T C 9: 104,165,022 R2005G possibly damaging Het
Dopey1 G A 9: 86,507,669 G541S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Ephb3 C T 16: 21,218,518 H455Y possibly damaging Het
Eri1 A C 8: 35,482,623 C127G probably damaging Het
Faf1 A T 4: 109,925,956 E548D probably benign Het
Gm3285 C A 10: 77,862,360 C114* probably null Het
Gm9736 C T 10: 77,751,333 V8I unknown Het
Gnptab A T 10: 88,440,312 M1154L probably benign Het
Grin1 G A 2: 25,296,635 T770M probably damaging Het
Haus1 A G 18: 77,766,870 S67P possibly damaging Het
Homer1 C A 13: 93,356,054 Q184K probably benign Het
Hook2 A G 8: 84,997,051 T401A probably benign Het
Il6st G A 13: 112,495,373 probably null Het
Kcnh8 A T 17: 52,905,010 D612V probably damaging Het
Ltbr C G 6: 125,312,800 E144Q probably benign Het
Mcf2l G T 8: 13,013,579 R961L possibly damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1b G T 1: 51,758,001 Q961K probably benign Het
Myo1h C A 5: 114,342,197 T531N Het
Ngly1 G A 14: 16,283,445 R408Q probably damaging Het
Nup133 T C 8: 123,906,227 E1055G possibly damaging Het
Nutm2 A G 13: 50,472,898 K363R probably benign Het
Obox8 A T 7: 14,332,827 Y97* probably null Het
Odc1 A G 12: 17,547,318 D7G probably benign Het
Ogfod2 C T 5: 124,114,495 T182I unknown Het
Olfr1216 A T 2: 89,013,980 V28E possibly damaging Het
Olfr331 A G 11: 58,502,553 M7T probably benign Het
Olfr875 T C 9: 37,772,991 S111P probably damaging Het
Olfr910 G A 9: 38,539,670 M258I probably benign Het
Parp4 A G 14: 56,589,973 D188G probably benign Het
Phactr2 T C 10: 13,247,178 E400G probably benign Het
Phlpp1 G A 1: 106,172,667 V222M possibly damaging Het
Ppp1r16b T C 2: 158,761,763 V536A probably damaging Het
Prex2 T C 1: 11,153,609 V719A possibly damaging Het
Prpf8 C T 11: 75,490,400 A242V possibly damaging Het
Prr14l A G 5: 32,829,427 L908P probably damaging Het
Prrc2b A G 2: 32,226,993 N2146D possibly damaging Het
Rtkn T C 6: 83,150,012 V333A possibly damaging Het
Samd8 T C 14: 21,775,374 Y196H probably benign Het
Six5 A G 7: 19,094,859 T75A probably benign Het
Slc35a4 T A 18: 36,681,538 L42H probably damaging Het
Svs3a A T 2: 164,290,013 D168V probably damaging Het
Themis T A 10: 28,761,426 Y175* probably null Het
Tspan33 G T 6: 29,716,784 R180L probably benign Het
Ttc28 C T 5: 111,085,092 S145F probably damaging Het
Txn2 G A 15: 77,926,678 T102I unknown Het
Usp34 T A 11: 23,426,183 V1908E Het
Vmn2r101 A G 17: 19,589,088 I160V probably null Het
Vmn2r104 A T 17: 20,030,096 C638S possibly damaging Het
Wdfy4 C T 14: 32,960,820 R3136Q Het
Zan C A 5: 137,398,290 A4335S unknown Het
Zfp180 G T 7: 24,104,533 V126F probably benign Het
Zfp429 T A 13: 67,390,812 D171V possibly damaging Het
Zfp638 T C 6: 83,954,726 I798T probably benign Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTGTGGTATTAGAGGGC -3'
(R):5'- TCAGGGCTCAGCTTATCTTGG -3'

Sequencing Primer
(F):5'- CTGAGTAGTTGATGGGCAGAACC -3'
(R):5'- TAACCAGGGTCCTTTGGAAC -3'
Posted On2019-05-15