Incidental Mutation 'R7101:Vmn2r101'
ID550860
Institutional Source Beutler Lab
Gene Symbol Vmn2r101
Ensembl Gene ENSMUSG00000094892
Gene Namevomeronasal 2, receptor 101
SynonymsEG627576
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7101 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location19577231-19612317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19589088 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 160 (I160V)
Ref Sequence ENSEMBL: ENSMUSP00000131583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171914]
Predicted Effect probably null
Transcript: ENSMUST00000171914
AA Change: I160V

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131583
Gene: ENSMUSG00000094892
AA Change: I160V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 466 1.6e-36 PFAM
Pfam:NCD3G 509 562 6.4e-22 PFAM
Pfam:7tm_3 595 830 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,511,171 S414R possibly damaging Het
Adam25 A G 8: 40,755,401 D568G probably benign Het
Angpt1 T C 15: 42,523,569 I130V probably benign Het
Ankrd11 G T 8: 122,895,455 Q553K probably benign Het
Ankrd42 A T 7: 92,631,544 H59Q possibly damaging Het
Ankrd52 C T 10: 128,382,380 R318C probably damaging Het
Arrdc5 G A 17: 56,294,522 T201M probably damaging Het
Atxn1l A G 8: 109,732,500 S377P probably benign Het
Baz2a T C 10: 128,121,187 F936S possibly damaging Het
Bicc1 T C 10: 70,930,653 D913G probably damaging Het
Blnk T A 19: 40,972,638 M21L probably benign Het
Cabin1 T C 10: 75,751,567 H132R probably benign Het
Ccdc154 A G 17: 25,163,468 H88R probably benign Het
Clic5 G T 17: 44,275,292 A223S probably benign Het
Col28a1 T A 6: 8,014,795 Y870F possibly damaging Het
Dhx37 G A 5: 125,424,942 Q497* probably null Het
Dnah11 T C 12: 118,068,145 T1763A probably benign Het
Dnajc13 T C 9: 104,165,022 R2005G possibly damaging Het
Dopey1 G A 9: 86,507,669 G541S probably benign Het
Drosha C T 15: 12,865,067 T627M probably damaging Het
Ephb3 C T 16: 21,218,518 H455Y possibly damaging Het
Eri1 A C 8: 35,482,623 C127G probably damaging Het
Faf1 A T 4: 109,925,956 E548D probably benign Het
Gm3285 C A 10: 77,862,360 C114* probably null Het
Gm9736 C T 10: 77,751,333 V8I unknown Het
Gnptab A T 10: 88,440,312 M1154L probably benign Het
Grin1 G A 2: 25,296,635 T770M probably damaging Het
Haus1 A G 18: 77,766,870 S67P possibly damaging Het
Homer1 C A 13: 93,356,054 Q184K probably benign Het
Hook2 A G 8: 84,997,051 T401A probably benign Het
Il6st G A 13: 112,495,373 probably null Het
Kcnh8 A T 17: 52,905,010 D612V probably damaging Het
Ltbr C G 6: 125,312,800 E144Q probably benign Het
Mcf2l G T 8: 13,013,579 R961L possibly damaging Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo1b G T 1: 51,758,001 Q961K probably benign Het
Myo1h C A 5: 114,342,197 T531N Het
Ngly1 G A 14: 16,283,445 R408Q probably damaging Het
Nup133 T C 8: 123,906,227 E1055G possibly damaging Het
Nutm2 A G 13: 50,472,898 K363R probably benign Het
Obox8 A T 7: 14,332,827 Y97* probably null Het
Odc1 A G 12: 17,547,318 D7G probably benign Het
Ogfod2 C T 5: 124,114,495 T182I unknown Het
Olfr1216 A T 2: 89,013,980 V28E possibly damaging Het
Olfr331 A G 11: 58,502,553 M7T probably benign Het
Olfr875 T C 9: 37,772,991 S111P probably damaging Het
Olfr910 G A 9: 38,539,670 M258I probably benign Het
Parp4 A G 14: 56,589,973 D188G probably benign Het
Phactr2 T C 10: 13,247,178 E400G probably benign Het
Phlpp1 G A 1: 106,172,667 V222M possibly damaging Het
Ppp1r16b T C 2: 158,761,763 V536A probably damaging Het
Prex2 T C 1: 11,153,609 V719A possibly damaging Het
Prpf8 C T 11: 75,490,400 A242V possibly damaging Het
Prr14l A G 5: 32,829,427 L908P probably damaging Het
Prrc2b A G 2: 32,226,993 N2146D possibly damaging Het
Rtkn T C 6: 83,150,012 V333A possibly damaging Het
Samd8 T C 14: 21,775,374 Y196H probably benign Het
Six5 A G 7: 19,094,859 T75A probably benign Het
Slc35a4 T A 18: 36,681,538 L42H probably damaging Het
Svs3a A T 2: 164,290,013 D168V probably damaging Het
Themis T A 10: 28,761,426 Y175* probably null Het
Tspan33 G T 6: 29,716,784 R180L probably benign Het
Ttc28 C T 5: 111,085,092 S145F probably damaging Het
Txn2 G A 15: 77,926,678 T102I unknown Het
Usp34 T A 11: 23,426,183 V1908E Het
Vmn2r104 A T 17: 20,030,096 C638S possibly damaging Het
Wdfy4 C T 14: 32,960,820 R3136Q Het
Zan C A 5: 137,398,290 A4335S unknown Het
Zfp180 G T 7: 24,104,533 V126F probably benign Het
Zfp429 T A 13: 67,390,812 D171V possibly damaging Het
Zfp638 T C 6: 83,954,726 I798T probably benign Het
Other mutations in Vmn2r101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Vmn2r101 APN 17 19589674 missense probably damaging 0.99
IGL02125:Vmn2r101 APN 17 19589701 missense possibly damaging 0.95
IGL02300:Vmn2r101 APN 17 19611937 missense probably damaging 1.00
IGL02682:Vmn2r101 APN 17 19612245 missense possibly damaging 0.82
IGL02825:Vmn2r101 APN 17 19589870 missense probably benign 0.00
IGL02862:Vmn2r101 APN 17 19611605 missense probably damaging 1.00
IGL02943:Vmn2r101 APN 17 19611404 missense probably damaging 0.99
R0371:Vmn2r101 UTSW 17 19590132 missense probably benign 0.07
R0462:Vmn2r101 UTSW 17 19590169 missense probably benign 0.04
R0492:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
R0654:Vmn2r101 UTSW 17 19590111 missense probably benign 0.01
R1120:Vmn2r101 UTSW 17 19577461 splice site probably benign
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1676:Vmn2r101 UTSW 17 19611922 missense probably benign 0.00
R2023:Vmn2r101 UTSW 17 19590106 nonsense probably null
R2149:Vmn2r101 UTSW 17 19588963 missense probably benign 0.00
R2350:Vmn2r101 UTSW 17 19589783 missense probably benign 0.01
R2760:Vmn2r101 UTSW 17 19589639 missense probably benign 0.14
R3085:Vmn2r101 UTSW 17 19588815 splice site probably null
R3086:Vmn2r101 UTSW 17 19588815 splice site probably null
R3719:Vmn2r101 UTSW 17 19589549 missense possibly damaging 0.50
R3771:Vmn2r101 UTSW 17 19589657 missense probably benign
R3773:Vmn2r101 UTSW 17 19589657 missense probably benign
R4225:Vmn2r101 UTSW 17 19611689 missense probably damaging 1.00
R4248:Vmn2r101 UTSW 17 19589114 missense probably damaging 1.00
R4290:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4291:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4293:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4307:Vmn2r101 UTSW 17 19590161 missense probably damaging 1.00
R4721:Vmn2r101 UTSW 17 19612025 missense probably damaging 0.99
R4829:Vmn2r101 UTSW 17 19611967 missense probably benign 0.03
R5022:Vmn2r101 UTSW 17 19611387 critical splice acceptor site probably null
R5110:Vmn2r101 UTSW 17 19611635 missense possibly damaging 0.92
R5244:Vmn2r101 UTSW 17 19611526 missense probably damaging 1.00
R5397:Vmn2r101 UTSW 17 19588842 missense probably damaging 1.00
R5875:Vmn2r101 UTSW 17 19588830 missense probably damaging 0.99
R5944:Vmn2r101 UTSW 17 19589507 missense probably benign 0.00
R6216:Vmn2r101 UTSW 17 19591005 missense probably benign 0.00
R6334:Vmn2r101 UTSW 17 19589850 missense possibly damaging 0.83
R6512:Vmn2r101 UTSW 17 19588884 missense probably damaging 1.00
R6607:Vmn2r101 UTSW 17 19612034 missense probably damaging 1.00
R6965:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R7183:Vmn2r101 UTSW 17 19612178 missense probably damaging 1.00
R7344:Vmn2r101 UTSW 17 19611797 missense probably benign 0.38
R7375:Vmn2r101 UTSW 17 19611390 missense probably damaging 1.00
R7574:Vmn2r101 UTSW 17 19611637 missense possibly damaging 0.91
R7575:Vmn2r101 UTSW 17 19611392 missense probably benign 0.01
R7592:Vmn2r101 UTSW 17 19591181 splice site probably null
R7626:Vmn2r101 UTSW 17 19611930 nonsense probably null
R7715:Vmn2r101 UTSW 17 19611915 missense probably damaging 1.00
R7730:Vmn2r101 UTSW 17 19611688 missense possibly damaging 0.81
Z1088:Vmn2r101 UTSW 17 19588975 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGCTACCCAACATATCTCTTGG -3'
(R):5'- CTCTCTCAAGGGTTTACTGGATTTC -3'

Sequencing Primer
(F):5'- ACCCAACATATCTCTTGGTTTTG -3'
(R):5'- CCAATCTTTAATTTGCAAGGAAGAG -3'
Posted On2019-05-15