Incidental Mutation 'R0595:Tap2'
ID55087
Institutional Source Beutler Lab
Gene Symbol Tap2
Ensembl Gene ENSMUSG00000024339
Gene Nametransporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
SynonymsAbcb3, Ham-2, HAM2, Ham2, MTP2, PSF2, Tap-2
MMRRC Submission 038785-MU
Accession Numbers

Genbank: NM_011530; MGI: 98484

Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0595 (G1)
Quality Score220
Status Validated
Chromosome17
Chromosomal Location34203527-34216321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34212354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 422 (V422D)
Ref Sequence ENSEMBL: ENSMUSP00000025197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025197] [ENSMUST00000121995]
Predicted Effect probably damaging
Transcript: ENSMUST00000025197
AA Change: V422D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025197
Gene: ENSMUSG00000024339
AA Change: V422D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
Pfam:ABC_membrane 151 419 1.8e-62 PFAM
AAA 494 678 2.58e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121995
SMART Domains Protein: ENSMUSP00000112395
Gene: ENSMUSG00000081512

DomainStartEndE-ValueType
low complexity region 124 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145528
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Chemically induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Ifitm1 T A 7: 140,968,329 I25N possibly damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Tap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tap2 APN 17 34215378 missense probably benign 0.09
IGL00802:Tap2 APN 17 34209130 missense probably damaging 0.96
IGL01291:Tap2 APN 17 34209210 missense probably benign 0.01
IGL01337:Tap2 APN 17 34205412 unclassified probably benign
IGL01549:Tap2 APN 17 34214329 missense probably benign 0.12
IGL02433:Tap2 APN 17 34205419 unclassified probably benign
IGL02488:Tap2 APN 17 34214642 unclassified probably benign
IGL02657:Tap2 APN 17 34205458 missense probably damaging 0.99
IGL02677:Tap2 APN 17 34212047 missense probably benign 0.20
IGL03183:Tap2 APN 17 34205425 unclassified probably benign
date UTSW 17 34212354 missense probably damaging 0.99
date2 UTSW 17 34214032 nonsense probably null
ganymede UTSW 17 small insertion
hebe UTSW 17 small insertion
juventas UTSW 17 small insertion
palm UTSW 17 34215940 missense possibly damaging 0.64
3370:Tap2 UTSW 17 34209279 unclassified probably null
ANU05:Tap2 UTSW 17 34209210 missense probably benign 0.01
FR4976:Tap2 UTSW 17 34205699 unclassified probably benign
R0841:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1145:Tap2 UTSW 17 34215940 missense possibly damaging 0.64
R1296:Tap2 UTSW 17 34211915 missense probably benign 0.12
R1567:Tap2 UTSW 17 34214091 missense probably benign 0.00
R1656:Tap2 UTSW 17 34205953 missense possibly damaging 0.64
R1693:Tap2 UTSW 17 34209212 missense probably benign 0.00
R2246:Tap2 UTSW 17 34208801 missense possibly damaging 0.82
R2251:Tap2 UTSW 17 34211954 missense probably damaging 0.98
R2937:Tap2 UTSW 17 34212354 missense possibly damaging 0.80
R4682:Tap2 UTSW 17 34214032 nonsense probably null
R5262:Tap2 UTSW 17 34214016 missense probably benign
R6052:Tap2 UTSW 17 34214709 missense probably damaging 1.00
R6151:Tap2 UTSW 17 34212047 missense probably benign 0.00
R6196:Tap2 UTSW 17 34214410 missense possibly damaging 0.50
R7020:Tap2 UTSW 17 34214414 missense possibly damaging 0.78
R7677:Tap2 UTSW 17 34205520 missense probably benign 0.01
R7694:Tap2 UTSW 17 34205697 missense probably benign
Z1177:Tap2 UTSW 17 34205668 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATTCTGGCTGGAGAGGTCAC -3'
(R):5'- GCAGTTAGGGATAAGATTAGCCAGG -3'

Sequencing Primer
(F):5'- TGGAGAGGTCACCCGGGGTG -3'
(R):5'- TAATTTAGGGTGGAGTCAGG -3'
Posted On2013-07-11