Mutagenetix > Incidental Mutation

Incidental Mutation 'R7102:Scn9a'

550877

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7102 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66549015 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 358 (M358L)

Ref Sequence

ENSEMBL: ENSMUSP00000097642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

probably damaging
Transcript: ENSMUST00000100063
AA Change: M360L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: M360L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100064
AA Change: M358L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: M358L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112354
AA Change: M358L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: M358L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164384
AA Change: M358L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: M358L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169900
AA Change: M358L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: M358L

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	T	A	19: 5,503,595	T53S	probably benign	Het
4932438A13Rik	T	G	3: 36,940,798	Y990D	probably damaging	Het
Abca13	A	T	11: 9,335,215	H3283L	probably damaging	Het
Abcb1a	T	G	5: 8,694,072	S233A	probably benign	Het
Actr10	T	C	12: 70,953,031		probably null	Het
Acvr2b	C	T	9: 119,432,553	A380V	probably damaging	Het
Adcy5	A	G	16: 35,299,625	E1168G	probably damaging	Het
Akap12	C	T	10: 4,353,226	T117I	probably damaging	Het
Alox5	T	A	6: 116,413,468	Y516F	probably benign	Het
Amigo2	T	C	15: 97,245,860	N227S	probably damaging	Het
Anpep	C	A	7: 79,836,313	V554L	probably benign	Het
Ap5b1	T	A	19: 5,570,187	V545E	possibly damaging	Het
Bbs9	C	T	9: 22,579,553	L326F	probably damaging	Het
Cadps	C	T	14: 12,603,738	G361R	probably damaging	Het
Ccdc57	C	A	11: 120,921,731	E66*	probably null	Het
Ccr6	G	A	17: 8,256,187	V75I	probably benign	Het
Cdk6	T	C	5: 3,520,709	F300S	probably damaging	Het
Cenpb	A	C	2: 131,178,879	V333G	probably damaging	Het
Clca4a	T	C	3: 144,961,909	I434V	probably benign	Het
Coro2b	T	A	9: 62,421,385	D447V	possibly damaging	Het
Cpeb3	T	C	19: 37,174,719	S86G	probably benign	Het
Cry2	C	A	2: 92,413,093	A468S	probably damaging	Het
Csf2rb2	T	C	15: 78,297,072	Y40C	probably damaging	Het
Ddx49	T	A	8: 70,301,076	T48S	probably damaging	Het
Dip2c	A	G	13: 9,604,536	T727A	probably benign	Het
Ebf4	A	T	2: 130,309,731	I183F	probably benign	Het
Elavl3	G	T	9: 22,018,729	P293Q	possibly damaging	Het
Esyt1	A	T	10: 128,516,236	L768Q	probably damaging	Het
Fam45a	T	A	19: 60,832,596	M272K	probably damaging	Het
Fat2	G	A	11: 55,283,434	P2151L	probably damaging	Het
Fgfbp3	G	T	19: 36,919,206	A4E	possibly damaging	Het
Flg	T	A	3: 93,293,028	V277D	unknown	Het
Fndc3b	T	C	3: 27,470,234	D459G	possibly damaging	Het
Fras1	A	G	5: 96,571,041	Q438R	probably benign	Het
Glipr1l2	A	T	10: 112,092,425		probably null	Het
Gm7347	T	A	5: 26,057,384		probably null	Het
Grm6	G	A	11: 50,862,977	V703I	possibly damaging	Het
Gtf2h1	T	A	7: 46,819,126	V496E	probably benign	Het
Ifna12	A	G	4: 88,603,151	L53P	probably damaging	Het
Invs	T	A	4: 48,407,674	S550T	probably benign	Het
Irak2	G	T	6: 113,686,849	C453F	probably damaging	Het
Itih2	G	T	2: 10,105,763	Q506K	probably benign	Het
Kidins220	T	C	12: 25,057,663	I1614T	probably benign	Het
Krtap5-3	T	A	7: 142,202,255	C276*	probably null	Het
Lama3	T	A	18: 12,552,813	M1128K	possibly damaging	Het
Lhfpl4	C	T	6: 113,194,145	A27T	possibly damaging	Het
Lyplal1	A	G	1: 186,100,327	V77A	probably damaging	Het
Malrd1	A	T	2: 16,142,303	E1985D	unknown	Het
Mlx	A	C	11: 101,088,976	Q161P	probably benign	Het
Mroh2b	T	A	15: 4,948,003	M1279K	probably benign	Het
Myh7b	A	G	2: 155,622,199	E540G	probably damaging	Het
Neb	T	A	2: 52,304,055	D653V	probably damaging	Het
Nek10	T	A	14: 14,828,517	L113Q	probably damaging	Het
Nlrp4c	T	A	7: 6,065,709	L203*	probably null	Het
Ntpcr	T	A	8: 125,730,055	C5S	unknown	Het
Nwd1	A	G	8: 72,695,329	D1001G	probably damaging	Het
Olfr1184	T	A	2: 88,487,148	C139S	probably damaging	Het
Olfr294	C	T	7: 86,616,267	C126Y	probably benign	Het
Olfr536	T	A	7: 140,504,316	T48S	probably benign	Het
Olfr784	A	C	10: 129,388,167	D178A	probably damaging	Het
Osbpl3	T	A	6: 50,320,135	S564C	probably damaging	Het
Pax6	C	A	2: 105,692,259	P264T	probably damaging	Het
Plppr4	T	C	3: 117,323,183	R342G	probably damaging	Het
Prg4	C	T	1: 150,452,254	C220Y	probably damaging	Het
Prune2	T	A	19: 17,121,213	D1360E	probably benign	Het
Ranbp2	T	A	10: 58,463,950	S469T	probably damaging	Het
Rbfox1	A	T	16: 7,369,834	K43N	probably benign	Het
Rgs22	T	C	15: 36,122,313	D25G	probably damaging	Het
Rnf113a2	G	A	12: 84,417,771	G146S	probably damaging	Het
Sbpl	T	A	17: 23,954,634	K55*	probably null	Het
Scel	G	A	14: 103,543,832	W138*	probably null	Het
Scgb2b19	T	C	7: 33,280,286	I12V	probably null	Het
Sdk2	C	A	11: 113,842,690	E924*	probably null	Het
Sipa1l3	T	C	7: 29,348,587	Q1292R	possibly damaging	Het
Skint4	G	A	4: 112,118,101	G86D	probably damaging	Het
Slc28a3	C	T	13: 58,588,214	V57I	probably benign	Het
Slc9a4	C	T	1: 40,580,639	P42S	probably benign	Het
Slc9a4	T	C	1: 40,623,399	S609P	probably damaging	Het
Slitrk1	T	A	14: 108,912,629	T217S	probably benign	Het
Spindoc	C	T	19: 7,358,442	R327H	probably benign	Het
Stk36	T	C	1: 74,622,223	S470P	probably benign	Het
Sypl	C	T	12: 32,974,255	P196L	probably benign	Het
Tekt4	T	A	17: 25,474,744	I285N	probably damaging	Het
Tgm5	T	A	2: 121,046,498	I686F	possibly damaging	Het
Thsd4	C	A	9: 59,976,304	R933L	probably damaging	Het
Treml1	T	A	17: 48,366,672	I237N	probably damaging	Het
Txndc16	T	C	14: 45,205,382	I119V	probably benign	Het
Ubr3	C	A	2: 69,897,822	N176K	probably damaging	Het
Vit	A	G	17: 78,624,997	Y511C	probably damaging	Het
Vwa5b2	G	A	16: 20,604,234	G994D	probably benign	Het
Wdr63	A	T	3: 146,055,704	S632R	possibly damaging	Het
Wnk1	T	C	6: 119,948,307	T1648A	unknown	Het
Ythdf1	G	A	2: 180,911,522	T300I	probably damaging	Het
Zan	A	G	5: 137,454,200		probably null	Het
Zbbx	A	G	3: 75,112,094	L103P	probably benign	Het
Zfp105	A	G	9: 122,929,804	D180G	probably damaging	Het
Zfp114	T	A	7: 24,180,658	L144Q	possibly damaging	Het
Zfp128	T	C	7: 12,890,472	C256R	probably damaging	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
R9443:Scn9a	UTSW	2	66565209	missense	probably damaging	1.00
R9590:Scn9a	UTSW	2	66483984	missense	probably benign	0.05
R9612:Scn9a	UTSW	2	66533364	missense	probably damaging	1.00
R9617:Scn9a	UTSW	2	66562465	missense	probably damaging	1.00
R9717:Scn9a	UTSW	2	66526658	missense	probably benign
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AATGCACATTAGGGAGTCCC -3'
(R):5'- ATGGTGCTATGGACAGATAGTG -3'

Sequencing Primer
(F):5'- AGTCCCAGACTGTCTGCAG -3'
(R):5'- TTCCACTGCAGGAAAGTGTAC -3'

Posted On

2019-05-15