Incidental Mutation 'R7102:Pax6'
ID550881
Institutional Source Beutler Lab
Gene Symbol Pax6
Ensembl Gene ENSMUSG00000027168
Gene Namepaired box 6
SynonymsGsfaey11, Dey, Dickie's small eye, AEY11, Pax-6, 1500038E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7102 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location105668900-105697364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105692259 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 264 (P264T)
Ref Sequence ENSEMBL: ENSMUSP00000087870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090391] [ENSMUST00000090397] [ENSMUST00000111082] [ENSMUST00000111083] [ENSMUST00000111085] [ENSMUST00000111086] [ENSMUST00000111087] [ENSMUST00000111088] [ENSMUST00000167211]
Predicted Effect probably damaging
Transcript: ENSMUST00000090391
AA Change: P264T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087870
Gene: ENSMUSG00000027168
AA Change: P264T

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090397
AA Change: P250T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087878
Gene: ENSMUSG00000027168
AA Change: P250T

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111082
AA Change: P250T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106711
Gene: ENSMUSG00000027168
AA Change: P250T

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111083
AA Change: P250T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106712
Gene: ENSMUSG00000027168
AA Change: P250T

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111085
AA Change: P264T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106714
Gene: ENSMUSG00000027168
AA Change: P264T

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111086
AA Change: P264T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106715
Gene: ENSMUSG00000027168
AA Change: P264T

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111087
AA Change: P250T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106716
Gene: ENSMUSG00000027168
AA Change: P250T

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111088
AA Change: P79T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106717
Gene: ENSMUSG00000027168
AA Change: P79T

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
HOX 39 101 4.93e-26 SMART
low complexity region 110 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167211
AA Change: P264T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129344
Gene: ENSMUSG00000027168
AA Change: P264T

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homeobox-containing protein that functions as a regulator of transcription. It plays a key role in the development of neural tissues, particularly the eye. Activity of this protein is also required for expression of glucagon in the pancreas. This gene is regulated by multiple enhancers located up to tens or hundreds of kilobases upstream and downstream of the transcription start sites. Mutations in this gene or deletion of these regulatory elements results in severe defects in eye development. Alternative splicing and the use of alternative promoters results in multiple transcript variants, some of which encode proteins that lack the N-terminal paired domain. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null and hypomorphic mutants show a range of phenotypes from viable with small eyes and lens/cornea fusion to microphthalmia and cataract to embryonic or perinatal lethality with anophthalmia and severe craniofacial and forebrain defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,595 T53S probably benign Het
4932438A13Rik T G 3: 36,940,798 Y990D probably damaging Het
Abca13 A T 11: 9,335,215 H3283L probably damaging Het
Abcb1a T G 5: 8,694,072 S233A probably benign Het
Actr10 T C 12: 70,953,031 probably null Het
Acvr2b C T 9: 119,432,553 A380V probably damaging Het
Adcy5 A G 16: 35,299,625 E1168G probably damaging Het
Akap12 C T 10: 4,353,226 T117I probably damaging Het
Alox5 T A 6: 116,413,468 Y516F probably benign Het
Amigo2 T C 15: 97,245,860 N227S probably damaging Het
Anpep C A 7: 79,836,313 V554L probably benign Het
Ap5b1 T A 19: 5,570,187 V545E possibly damaging Het
Bbs9 C T 9: 22,579,553 L326F probably damaging Het
Cadps C T 14: 12,603,738 G361R probably damaging Het
Ccdc57 C A 11: 120,921,731 E66* probably null Het
Ccr6 G A 17: 8,256,187 V75I probably benign Het
Cdk6 T C 5: 3,520,709 F300S probably damaging Het
Cenpb A C 2: 131,178,879 V333G probably damaging Het
Clca4a T C 3: 144,961,909 I434V probably benign Het
Coro2b T A 9: 62,421,385 D447V possibly damaging Het
Cpeb3 T C 19: 37,174,719 S86G probably benign Het
Cry2 C A 2: 92,413,093 A468S probably damaging Het
Csf2rb2 T C 15: 78,297,072 Y40C probably damaging Het
Ddx49 T A 8: 70,301,076 T48S probably damaging Het
Dip2c A G 13: 9,604,536 T727A probably benign Het
Ebf4 A T 2: 130,309,731 I183F probably benign Het
Elavl3 G T 9: 22,018,729 P293Q possibly damaging Het
Esyt1 A T 10: 128,516,236 L768Q probably damaging Het
Fam45a T A 19: 60,832,596 M272K probably damaging Het
Fat2 G A 11: 55,283,434 P2151L probably damaging Het
Fgfbp3 G T 19: 36,919,206 A4E possibly damaging Het
Flg T A 3: 93,293,028 V277D unknown Het
Fndc3b T C 3: 27,470,234 D459G possibly damaging Het
Fras1 A G 5: 96,571,041 Q438R probably benign Het
Glipr1l2 A T 10: 112,092,425 probably null Het
Gm7347 T A 5: 26,057,384 probably null Het
Grm6 G A 11: 50,862,977 V703I possibly damaging Het
Gtf2h1 T A 7: 46,819,126 V496E probably benign Het
Ifna12 A G 4: 88,603,151 L53P probably damaging Het
Invs T A 4: 48,407,674 S550T probably benign Het
Irak2 G T 6: 113,686,849 C453F probably damaging Het
Itih2 G T 2: 10,105,763 Q506K probably benign Het
Kidins220 T C 12: 25,057,663 I1614T probably benign Het
Krtap5-3 T A 7: 142,202,255 C276* probably null Het
Lama3 T A 18: 12,552,813 M1128K possibly damaging Het
Lhfpl4 C T 6: 113,194,145 A27T possibly damaging Het
Lyplal1 A G 1: 186,100,327 V77A probably damaging Het
Malrd1 A T 2: 16,142,303 E1985D unknown Het
Mlx A C 11: 101,088,976 Q161P probably benign Het
Mroh2b T A 15: 4,948,003 M1279K probably benign Het
Myh7b A G 2: 155,622,199 E540G probably damaging Het
Neb T A 2: 52,304,055 D653V probably damaging Het
Nek10 T A 14: 14,828,517 L113Q probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Ntpcr T A 8: 125,730,055 C5S unknown Het
Nwd1 A G 8: 72,695,329 D1001G probably damaging Het
Olfr1184 T A 2: 88,487,148 C139S probably damaging Het
Olfr294 C T 7: 86,616,267 C126Y probably benign Het
Olfr536 T A 7: 140,504,316 T48S probably benign Het
Olfr784 A C 10: 129,388,167 D178A probably damaging Het
Osbpl3 T A 6: 50,320,135 S564C probably damaging Het
Plppr4 T C 3: 117,323,183 R342G probably damaging Het
Prg4 C T 1: 150,452,254 C220Y probably damaging Het
Prune2 T A 19: 17,121,213 D1360E probably benign Het
Ranbp2 T A 10: 58,463,950 S469T probably damaging Het
Rbfox1 A T 16: 7,369,834 K43N probably benign Het
Rgs22 T C 15: 36,122,313 D25G probably damaging Het
Rnf113a2 G A 12: 84,417,771 G146S probably damaging Het
Sbpl T A 17: 23,954,634 K55* probably null Het
Scel G A 14: 103,543,832 W138* probably null Het
Scgb2b19 T C 7: 33,280,286 I12V probably null Het
Scn9a T A 2: 66,549,015 M358L probably damaging Het
Sdk2 C A 11: 113,842,690 E924* probably null Het
Sipa1l3 T C 7: 29,348,587 Q1292R possibly damaging Het
Skint4 G A 4: 112,118,101 G86D probably damaging Het
Slc28a3 C T 13: 58,588,214 V57I probably benign Het
Slc9a4 C T 1: 40,580,639 P42S probably benign Het
Slc9a4 T C 1: 40,623,399 S609P probably damaging Het
Slitrk1 T A 14: 108,912,629 T217S probably benign Het
Spindoc C T 19: 7,358,442 R327H probably benign Het
Stk36 T C 1: 74,622,223 S470P probably benign Het
Sypl C T 12: 32,974,255 P196L probably benign Het
Tekt4 T A 17: 25,474,744 I285N probably damaging Het
Tgm5 T A 2: 121,046,498 I686F possibly damaging Het
Thsd4 C A 9: 59,976,304 R933L probably damaging Het
Treml1 T A 17: 48,366,672 I237N probably damaging Het
Txndc16 T C 14: 45,205,382 I119V probably benign Het
Ubr3 C A 2: 69,897,822 N176K probably damaging Het
Vit A G 17: 78,624,997 Y511C probably damaging Het
Vwa5b2 G A 16: 20,604,234 G994D probably benign Het
Wdr63 A T 3: 146,055,704 S632R possibly damaging Het
Wnk1 T C 6: 119,948,307 T1648A unknown Het
Ythdf1 G A 2: 180,911,522 T300I probably damaging Het
Zan A G 5: 137,454,200 probably null Het
Zbbx A G 3: 75,112,094 L103P probably benign Het
Zfp105 A G 9: 122,929,804 D180G probably damaging Het
Zfp114 T A 7: 24,180,658 L144Q possibly damaging Het
Zfp128 T C 7: 12,890,472 C256R probably damaging Het
Other mutations in Pax6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Pax6 APN 2 105692278 critical splice donor site probably null
IGL02256:Pax6 APN 2 105684770 missense probably benign 0.16
IGL02500:Pax6 APN 2 105692770 missense probably benign 0.13
red_hots UTSW 2 105695360 missense probably benign 0.00
R1067:Pax6 UTSW 2 105680301 missense probably benign 0.01
R1213:Pax6 UTSW 2 105685913 missense probably benign 0.13
R1494:Pax6 UTSW 2 105691610 missense probably benign 0.16
R1633:Pax6 UTSW 2 105691718 missense probably damaging 1.00
R2291:Pax6 UTSW 2 105685883 missense probably benign 0.09
R3834:Pax6 UTSW 2 105696450 missense probably benign 0.00
R3835:Pax6 UTSW 2 105696450 missense probably benign 0.00
R4665:Pax6 UTSW 2 105683998 intron probably benign
R4714:Pax6 UTSW 2 105695400 missense possibly damaging 0.74
R4747:Pax6 UTSW 2 105696502 missense probably benign
R4764:Pax6 UTSW 2 105696502 missense probably benign
R4767:Pax6 UTSW 2 105695360 missense probably benign 0.00
R4771:Pax6 UTSW 2 105696502 missense probably benign
R4772:Pax6 UTSW 2 105696502 missense probably benign
R4816:Pax6 UTSW 2 105683784 intron probably benign
R4819:Pax6 UTSW 2 105692277 critical splice donor site probably null
R5418:Pax6 UTSW 2 105691565 missense probably benign 0.00
R5683:Pax6 UTSW 2 105685907 missense probably benign 0.06
R6041:Pax6 UTSW 2 105683902 missense probably damaging 1.00
R6263:Pax6 UTSW 2 105692854 critical splice donor site probably null
R6651:Pax6 UTSW 2 105685830 missense probably benign 0.00
R6822:Pax6 UTSW 2 105685923 missense probably benign 0.04
R7042:Pax6 UTSW 2 105696373 missense probably benign
R7088:Pax6 UTSW 2 105696408 missense probably benign 0.00
R7294:Pax6 UTSW 2 105684901 nonsense probably null
R7761:Pax6 UTSW 2 105691691 missense probably damaging 1.00
R7948:Pax6 UTSW 2 105685877 missense not run
Z1177:Pax6 UTSW 2 105685816 missense not run
Predicted Primers PCR Primer
(F):5'- GCACACTGTCAAGCTGTCTG -3'
(R):5'- TACCTGGAAATGCACAGAACAG -3'

Sequencing Primer
(F):5'- CACACTGTCAAGCTGTCTGATTGG -3'
(R):5'- TGCACAGAACAGGTTAGCCCTATG -3'
Posted On2019-05-15