Incidental Mutation 'R7102:Fndc3b'
ID550887
Institutional Source Beutler Lab
Gene Symbol Fndc3b
Ensembl Gene ENSMUSG00000039286
Gene Namefibronectin type III domain containing 3B
Synonymsfad104, 1600019O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7102 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location27416162-27711307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27470234 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 459 (D459G)
Ref Sequence ENSEMBL: ENSMUSP00000041495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046157] [ENSMUST00000195008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046157
AA Change: D459G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041495
Gene: ENSMUSG00000039286
AA Change: D459G

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195008
AA Change: D459G

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141620
Gene: ENSMUSG00000039286
AA Change: D459G

DomainStartEndE-ValueType
low complexity region 119 132 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 224 246 N/A INTRINSIC
FN3 279 368 6.29e-8 SMART
FN3 382 463 8.31e-8 SMART
FN3 478 560 3.15e-8 SMART
FN3 575 659 4.28e-10 SMART
FN3 674 755 2.14e-10 SMART
FN3 770 849 1.98e-5 SMART
FN3 872 947 1.31e-5 SMART
FN3 961 1042 2.31e-6 SMART
FN3 1057 1137 1.2e-4 SMART
low complexity region 1165 1176 N/A INTRINSIC
transmembrane domain 1182 1204 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth despite normal energy homeostasis. Mouse embryonic fibroblasts homozygous for a knock-out allele exhibit impaired adipogenesis and enhanced osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,595 T53S probably benign Het
4932438A13Rik T G 3: 36,940,798 Y990D probably damaging Het
Abca13 A T 11: 9,335,215 H3283L probably damaging Het
Abcb1a T G 5: 8,694,072 S233A probably benign Het
Actr10 T C 12: 70,953,031 probably null Het
Acvr2b C T 9: 119,432,553 A380V probably damaging Het
Adcy5 A G 16: 35,299,625 E1168G probably damaging Het
Akap12 C T 10: 4,353,226 T117I probably damaging Het
Alox5 T A 6: 116,413,468 Y516F probably benign Het
Amigo2 T C 15: 97,245,860 N227S probably damaging Het
Anpep C A 7: 79,836,313 V554L probably benign Het
Ap5b1 T A 19: 5,570,187 V545E possibly damaging Het
Bbs9 C T 9: 22,579,553 L326F probably damaging Het
Cadps C T 14: 12,603,738 G361R probably damaging Het
Ccdc57 C A 11: 120,921,731 E66* probably null Het
Ccr6 G A 17: 8,256,187 V75I probably benign Het
Cdk6 T C 5: 3,520,709 F300S probably damaging Het
Cenpb A C 2: 131,178,879 V333G probably damaging Het
Clca4a T C 3: 144,961,909 I434V probably benign Het
Coro2b T A 9: 62,421,385 D447V possibly damaging Het
Cpeb3 T C 19: 37,174,719 S86G probably benign Het
Cry2 C A 2: 92,413,093 A468S probably damaging Het
Csf2rb2 T C 15: 78,297,072 Y40C probably damaging Het
Ddx49 T A 8: 70,301,076 T48S probably damaging Het
Dip2c A G 13: 9,604,536 T727A probably benign Het
Ebf4 A T 2: 130,309,731 I183F probably benign Het
Elavl3 G T 9: 22,018,729 P293Q possibly damaging Het
Esyt1 A T 10: 128,516,236 L768Q probably damaging Het
Fam45a T A 19: 60,832,596 M272K probably damaging Het
Fat2 G A 11: 55,283,434 P2151L probably damaging Het
Fgfbp3 G T 19: 36,919,206 A4E possibly damaging Het
Flg T A 3: 93,293,028 V277D unknown Het
Fras1 A G 5: 96,571,041 Q438R probably benign Het
Glipr1l2 A T 10: 112,092,425 probably null Het
Gm7347 T A 5: 26,057,384 probably null Het
Grm6 G A 11: 50,862,977 V703I possibly damaging Het
Gtf2h1 T A 7: 46,819,126 V496E probably benign Het
Ifna12 A G 4: 88,603,151 L53P probably damaging Het
Invs T A 4: 48,407,674 S550T probably benign Het
Irak2 G T 6: 113,686,849 C453F probably damaging Het
Itih2 G T 2: 10,105,763 Q506K probably benign Het
Kidins220 T C 12: 25,057,663 I1614T probably benign Het
Krtap5-3 T A 7: 142,202,255 C276* probably null Het
Lama3 T A 18: 12,552,813 M1128K possibly damaging Het
Lhfpl4 C T 6: 113,194,145 A27T possibly damaging Het
Lyplal1 A G 1: 186,100,327 V77A probably damaging Het
Malrd1 A T 2: 16,142,303 E1985D unknown Het
Mlx A C 11: 101,088,976 Q161P probably benign Het
Mroh2b T A 15: 4,948,003 M1279K probably benign Het
Myh7b A G 2: 155,622,199 E540G probably damaging Het
Neb T A 2: 52,304,055 D653V probably damaging Het
Nek10 T A 14: 14,828,517 L113Q probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Ntpcr T A 8: 125,730,055 C5S unknown Het
Nwd1 A G 8: 72,695,329 D1001G probably damaging Het
Olfr1184 T A 2: 88,487,148 C139S probably damaging Het
Olfr294 C T 7: 86,616,267 C126Y probably benign Het
Olfr536 T A 7: 140,504,316 T48S probably benign Het
Olfr784 A C 10: 129,388,167 D178A probably damaging Het
Osbpl3 T A 6: 50,320,135 S564C probably damaging Het
Pax6 C A 2: 105,692,259 P264T probably damaging Het
Plppr4 T C 3: 117,323,183 R342G probably damaging Het
Prg4 C T 1: 150,452,254 C220Y probably damaging Het
Prune2 T A 19: 17,121,213 D1360E probably benign Het
Ranbp2 T A 10: 58,463,950 S469T probably damaging Het
Rbfox1 A T 16: 7,369,834 K43N probably benign Het
Rgs22 T C 15: 36,122,313 D25G probably damaging Het
Rnf113a2 G A 12: 84,417,771 G146S probably damaging Het
Sbpl T A 17: 23,954,634 K55* probably null Het
Scel G A 14: 103,543,832 W138* probably null Het
Scgb2b19 T C 7: 33,280,286 I12V probably null Het
Scn9a T A 2: 66,549,015 M358L probably damaging Het
Sdk2 C A 11: 113,842,690 E924* probably null Het
Sipa1l3 T C 7: 29,348,587 Q1292R possibly damaging Het
Skint4 G A 4: 112,118,101 G86D probably damaging Het
Slc28a3 C T 13: 58,588,214 V57I probably benign Het
Slc9a4 C T 1: 40,580,639 P42S probably benign Het
Slc9a4 T C 1: 40,623,399 S609P probably damaging Het
Slitrk1 T A 14: 108,912,629 T217S probably benign Het
Spindoc C T 19: 7,358,442 R327H probably benign Het
Stk36 T C 1: 74,622,223 S470P probably benign Het
Sypl C T 12: 32,974,255 P196L probably benign Het
Tekt4 T A 17: 25,474,744 I285N probably damaging Het
Tgm5 T A 2: 121,046,498 I686F possibly damaging Het
Thsd4 C A 9: 59,976,304 R933L probably damaging Het
Treml1 T A 17: 48,366,672 I237N probably damaging Het
Txndc16 T C 14: 45,205,382 I119V probably benign Het
Ubr3 C A 2: 69,897,822 N176K probably damaging Het
Vit A G 17: 78,624,997 Y511C probably damaging Het
Vwa5b2 G A 16: 20,604,234 G994D probably benign Het
Wdr63 A T 3: 146,055,704 S632R possibly damaging Het
Wnk1 T C 6: 119,948,307 T1648A unknown Het
Ythdf1 G A 2: 180,911,522 T300I probably damaging Het
Zan A G 5: 137,454,200 probably null Het
Zbbx A G 3: 75,112,094 L103P probably benign Het
Zfp105 A G 9: 122,929,804 D180G probably damaging Het
Zfp114 T A 7: 24,180,658 L144Q possibly damaging Het
Zfp128 T C 7: 12,890,472 C256R probably damaging Het
Other mutations in Fndc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fndc3b APN 3 27538012 missense probably benign 0.40
IGL00848:Fndc3b APN 3 27451509 missense probably damaging 1.00
IGL01099:Fndc3b APN 3 27463817 missense probably benign 0.10
IGL01459:Fndc3b APN 3 27461740 missense probably benign 0.11
IGL01583:Fndc3b APN 3 27428995 missense probably damaging 1.00
IGL01736:Fndc3b APN 3 27467403 missense probably damaging 1.00
IGL02154:Fndc3b APN 3 27538117 missense probably damaging 0.99
IGL02377:Fndc3b APN 3 27620652 missense probably damaging 1.00
IGL02470:Fndc3b APN 3 27461720 missense probably damaging 1.00
IGL02508:Fndc3b APN 3 27458751 missense probably damaging 1.00
IGL02834:Fndc3b APN 3 27508503 missense probably damaging 1.00
IGL02974:Fndc3b APN 3 27488276 missense probably damaging 1.00
IGL02999:Fndc3b APN 3 27538239 missense probably damaging 1.00
IGL03083:Fndc3b APN 3 27467427 missense probably benign 0.10
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0040:Fndc3b UTSW 3 27556117 splice site probably null
R0101:Fndc3b UTSW 3 27458808 missense probably damaging 1.00
R0279:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0281:Fndc3b UTSW 3 27457006 missense probably benign 0.30
R0325:Fndc3b UTSW 3 27467430 missense probably damaging 1.00
R0398:Fndc3b UTSW 3 27461779 missense probably benign 0.19
R1334:Fndc3b UTSW 3 27458851 missense probably damaging 1.00
R1464:Fndc3b UTSW 3 27440185 splice site probably benign
R1961:Fndc3b UTSW 3 27456451 nonsense probably null
R1993:Fndc3b UTSW 3 27419400 missense probably benign
R2087:Fndc3b UTSW 3 27451554 missense probably benign 0.00
R2113:Fndc3b UTSW 3 27643036 missense probably damaging 1.00
R2258:Fndc3b UTSW 3 27440160 missense possibly damaging 0.93
R2437:Fndc3b UTSW 3 27451332 missense probably damaging 0.99
R2930:Fndc3b UTSW 3 27470286 missense probably benign
R2997:Fndc3b UTSW 3 27468872 missense probably benign 0.00
R3151:Fndc3b UTSW 3 27419503 missense possibly damaging 0.93
R3782:Fndc3b UTSW 3 27459986 missense possibly damaging 0.81
R4255:Fndc3b UTSW 3 27501407 missense possibly damaging 0.77
R4628:Fndc3b UTSW 3 27556128 missense probably benign 0.19
R4747:Fndc3b UTSW 3 27428965 missense probably damaging 0.98
R4849:Fndc3b UTSW 3 27459948 missense probably damaging 1.00
R5185:Fndc3b UTSW 3 27457070 missense probably benign 0.14
R5291:Fndc3b UTSW 3 27642995 missense probably benign 0.39
R5392:Fndc3b UTSW 3 27465787 nonsense probably null
R5540:Fndc3b UTSW 3 27501502 missense probably damaging 1.00
R5554:Fndc3b UTSW 3 27643013 missense possibly damaging 0.69
R5635:Fndc3b UTSW 3 27541931 missense probably damaging 1.00
R5639:Fndc3b UTSW 3 27426153 missense probably damaging 0.98
R5678:Fndc3b UTSW 3 27429023 missense probably benign
R5732:Fndc3b UTSW 3 27461773 missense probably damaging 1.00
R5880:Fndc3b UTSW 3 27428903 missense probably damaging 1.00
R6539:Fndc3b UTSW 3 27538057 missense probably benign 0.22
R7038:Fndc3b UTSW 3 27501469 missense probably benign 0.23
R7203:Fndc3b UTSW 3 27456485 missense probably benign 0.00
R7472:Fndc3b UTSW 3 27461744 missense probably benign 0.00
R7796:Fndc3b UTSW 3 27461743 missense probably benign 0.00
R7861:Fndc3b UTSW 3 27468999 missense possibly damaging 0.62
R8105:Fndc3b UTSW 3 27470225 missense probably benign 0.01
R8119:Fndc3b UTSW 3 27451344 missense probably benign 0.01
R8348:Fndc3b UTSW 3 27439995 missense probably benign
R8677:Fndc3b UTSW 3 27457027 missense probably benign 0.32
X0028:Fndc3b UTSW 3 27451434 missense possibly damaging 0.72
Z1088:Fndc3b UTSW 3 27465808 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGGCAGCTTCCTTTACAAAGC -3'
(R):5'- GGAAATGTCATGGCAAACCCC -3'

Sequencing Primer
(F):5'- TTCCCCCATGACAGCAGTGAG -3'
(R):5'- ACAGGTAGATGGAGAGTGCTATGTTC -3'
Posted On2019-05-15