Incidental Mutation 'R7102:Alox5'
ID550905
Institutional Source Beutler Lab
Gene Symbol Alox5
Ensembl Gene ENSMUSG00000025701
Gene Namearachidonate 5-lipoxygenase
Synonyms5LO, 5-LOX, 5LX
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R7102 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116410077-116461178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116413468 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 516 (Y516F)
Ref Sequence ENSEMBL: ENSMUSP00000026795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000164547] [ENSMUST00000170186] [ENSMUST00000203193] [ENSMUST00000203722]
Predicted Effect probably benign
Transcript: ENSMUST00000026795
AA Change: Y516F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: Y516F

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 212 662 1.5e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079012
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101032
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164547
AA Change: Y516F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: Y516F

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 125 217 5.1e-12 PFAM
Pfam:Lipoxygenase 213 564 8.4e-133 PFAM
Pfam:Lipoxygenase 558 609 7.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170186
AA Change: Y484F

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701
AA Change: Y484F

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 150 220 1.9e-13 PFAM
Pfam:Lipoxygenase 215 432 8.6e-79 PFAM
Pfam:Lipoxygenase 426 634 1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203193
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203722
SMART Domains Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701

DomainStartEndE-ValueType
LH2 2 115 2.2e-41 SMART
Pfam:Lipoxygenase 213 430 3e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,595 T53S probably benign Het
4932438A13Rik T G 3: 36,940,798 Y990D probably damaging Het
Abca13 A T 11: 9,335,215 H3283L probably damaging Het
Abcb1a T G 5: 8,694,072 S233A probably benign Het
Actr10 T C 12: 70,953,031 probably null Het
Acvr2b C T 9: 119,432,553 A380V probably damaging Het
Adcy5 A G 16: 35,299,625 E1168G probably damaging Het
Akap12 C T 10: 4,353,226 T117I probably damaging Het
Amigo2 T C 15: 97,245,860 N227S probably damaging Het
Anpep C A 7: 79,836,313 V554L probably benign Het
Ap5b1 T A 19: 5,570,187 V545E possibly damaging Het
Bbs9 C T 9: 22,579,553 L326F probably damaging Het
Cadps C T 14: 12,603,738 G361R probably damaging Het
Ccdc57 C A 11: 120,921,731 E66* probably null Het
Ccr6 G A 17: 8,256,187 V75I probably benign Het
Cdk6 T C 5: 3,520,709 F300S probably damaging Het
Cenpb A C 2: 131,178,879 V333G probably damaging Het
Clca4a T C 3: 144,961,909 I434V probably benign Het
Coro2b T A 9: 62,421,385 D447V possibly damaging Het
Cpeb3 T C 19: 37,174,719 S86G probably benign Het
Cry2 C A 2: 92,413,093 A468S probably damaging Het
Csf2rb2 T C 15: 78,297,072 Y40C probably damaging Het
Ddx49 T A 8: 70,301,076 T48S probably damaging Het
Dip2c A G 13: 9,604,536 T727A probably benign Het
Ebf4 A T 2: 130,309,731 I183F probably benign Het
Elavl3 G T 9: 22,018,729 P293Q possibly damaging Het
Esyt1 A T 10: 128,516,236 L768Q probably damaging Het
Fam45a T A 19: 60,832,596 M272K probably damaging Het
Fat2 G A 11: 55,283,434 P2151L probably damaging Het
Fgfbp3 G T 19: 36,919,206 A4E possibly damaging Het
Flg T A 3: 93,293,028 V277D unknown Het
Fndc3b T C 3: 27,470,234 D459G possibly damaging Het
Fras1 A G 5: 96,571,041 Q438R probably benign Het
Glipr1l2 A T 10: 112,092,425 probably null Het
Gm7347 T A 5: 26,057,384 probably null Het
Grm6 G A 11: 50,862,977 V703I possibly damaging Het
Gtf2h1 T A 7: 46,819,126 V496E probably benign Het
Ifna12 A G 4: 88,603,151 L53P probably damaging Het
Invs T A 4: 48,407,674 S550T probably benign Het
Irak2 G T 6: 113,686,849 C453F probably damaging Het
Itih2 G T 2: 10,105,763 Q506K probably benign Het
Kidins220 T C 12: 25,057,663 I1614T probably benign Het
Krtap5-3 T A 7: 142,202,255 C276* probably null Het
Lama3 T A 18: 12,552,813 M1128K possibly damaging Het
Lhfpl4 C T 6: 113,194,145 A27T possibly damaging Het
Lyplal1 A G 1: 186,100,327 V77A probably damaging Het
Malrd1 A T 2: 16,142,303 E1985D unknown Het
Mlx A C 11: 101,088,976 Q161P probably benign Het
Mroh2b T A 15: 4,948,003 M1279K probably benign Het
Myh7b A G 2: 155,622,199 E540G probably damaging Het
Neb T A 2: 52,304,055 D653V probably damaging Het
Nek10 T A 14: 14,828,517 L113Q probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Ntpcr T A 8: 125,730,055 C5S unknown Het
Nwd1 A G 8: 72,695,329 D1001G probably damaging Het
Olfr1184 T A 2: 88,487,148 C139S probably damaging Het
Olfr294 C T 7: 86,616,267 C126Y probably benign Het
Olfr536 T A 7: 140,504,316 T48S probably benign Het
Olfr784 A C 10: 129,388,167 D178A probably damaging Het
Osbpl3 T A 6: 50,320,135 S564C probably damaging Het
Pax6 C A 2: 105,692,259 P264T probably damaging Het
Plppr4 T C 3: 117,323,183 R342G probably damaging Het
Prg4 C T 1: 150,452,254 C220Y probably damaging Het
Prune2 T A 19: 17,121,213 D1360E probably benign Het
Ranbp2 T A 10: 58,463,950 S469T probably damaging Het
Rbfox1 A T 16: 7,369,834 K43N probably benign Het
Rgs22 T C 15: 36,122,313 D25G probably damaging Het
Rnf113a2 G A 12: 84,417,771 G146S probably damaging Het
Sbpl T A 17: 23,954,634 K55* probably null Het
Scel G A 14: 103,543,832 W138* probably null Het
Scgb2b19 T C 7: 33,280,286 I12V probably null Het
Scn9a T A 2: 66,549,015 M358L probably damaging Het
Sdk2 C A 11: 113,842,690 E924* probably null Het
Sipa1l3 T C 7: 29,348,587 Q1292R possibly damaging Het
Skint4 G A 4: 112,118,101 G86D probably damaging Het
Slc28a3 C T 13: 58,588,214 V57I probably benign Het
Slc9a4 C T 1: 40,580,639 P42S probably benign Het
Slc9a4 T C 1: 40,623,399 S609P probably damaging Het
Slitrk1 T A 14: 108,912,629 T217S probably benign Het
Spindoc C T 19: 7,358,442 R327H probably benign Het
Stk36 T C 1: 74,622,223 S470P probably benign Het
Sypl C T 12: 32,974,255 P196L probably benign Het
Tekt4 T A 17: 25,474,744 I285N probably damaging Het
Tgm5 T A 2: 121,046,498 I686F possibly damaging Het
Thsd4 C A 9: 59,976,304 R933L probably damaging Het
Treml1 T A 17: 48,366,672 I237N probably damaging Het
Txndc16 T C 14: 45,205,382 I119V probably benign Het
Ubr3 C A 2: 69,897,822 N176K probably damaging Het
Vit A G 17: 78,624,997 Y511C probably damaging Het
Vwa5b2 G A 16: 20,604,234 G994D probably benign Het
Wdr63 A T 3: 146,055,704 S632R possibly damaging Het
Wnk1 T C 6: 119,948,307 T1648A unknown Het
Ythdf1 G A 2: 180,911,522 T300I probably damaging Het
Zan A G 5: 137,454,200 probably null Het
Zbbx A G 3: 75,112,094 L103P probably benign Het
Zfp105 A G 9: 122,929,804 D180G probably damaging Het
Zfp114 T A 7: 24,180,658 L144Q possibly damaging Het
Zfp128 T C 7: 12,890,472 C256R probably damaging Het
Other mutations in Alox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Alox5 APN 6 116415517 missense probably damaging 1.00
IGL00954:Alox5 APN 6 116454299 missense probably damaging 1.00
IGL01610:Alox5 APN 6 116413547 missense probably damaging 1.00
IGL02161:Alox5 APN 6 116423193 missense probably benign 0.31
IGL02653:Alox5 APN 6 116415477 missense probably benign 0.41
IGL02903:Alox5 APN 6 116420335 missense probably damaging 1.00
clanger UTSW 6 116414595 missense probably damaging 1.00
Triangle UTSW 6 116427137 splice site probably null
R0265:Alox5 UTSW 6 116420362 missense probably benign 0.04
R0347:Alox5 UTSW 6 116413552 missense possibly damaging 0.88
R0543:Alox5 UTSW 6 116454317 critical splice acceptor site probably null
R0633:Alox5 UTSW 6 116420384 missense probably damaging 1.00
R0656:Alox5 UTSW 6 116423330 splice site probably benign
R1298:Alox5 UTSW 6 116427264 missense probably damaging 1.00
R1416:Alox5 UTSW 6 116423145 nonsense probably null
R1484:Alox5 UTSW 6 116454167 missense probably damaging 1.00
R1485:Alox5 UTSW 6 116424164 missense probably damaging 1.00
R1518:Alox5 UTSW 6 116413780 missense probably damaging 0.99
R1993:Alox5 UTSW 6 116415463 missense probably damaging 1.00
R2313:Alox5 UTSW 6 116413861 missense probably benign 0.00
R3125:Alox5 UTSW 6 116427137 splice site probably null
R4042:Alox5 UTSW 6 116461018 missense possibly damaging 0.95
R4092:Alox5 UTSW 6 116412674 intron probably benign
R4356:Alox5 UTSW 6 116420258 missense probably benign 0.05
R4367:Alox5 UTSW 6 116460963 missense possibly damaging 0.86
R4690:Alox5 UTSW 6 116423189 missense probably damaging 1.00
R4792:Alox5 UTSW 6 116461003 missense possibly damaging 0.94
R4873:Alox5 UTSW 6 116413850 splice site probably null
R4875:Alox5 UTSW 6 116413850 splice site probably null
R5135:Alox5 UTSW 6 116413786 missense probably benign 0.00
R5242:Alox5 UTSW 6 116460966 missense probably damaging 0.97
R5343:Alox5 UTSW 6 116413507 missense possibly damaging 0.95
R5780:Alox5 UTSW 6 116420349 missense probably benign 0.10
R6348:Alox5 UTSW 6 116414595 missense probably damaging 1.00
R6724:Alox5 UTSW 6 116414548 missense probably damaging 1.00
R6769:Alox5 UTSW 6 116415184 splice site probably null
R6954:Alox5 UTSW 6 116420280 nonsense probably null
R7476:Alox5 UTSW 6 116415433 missense probably benign 0.06
R7626:Alox5 UTSW 6 116413795 missense possibly damaging 0.94
R7690:Alox5 UTSW 6 116415456 missense probably damaging 1.00
R7912:Alox5 UTSW 6 116412536 missense probably benign 0.05
R8234:Alox5 UTSW 6 116413874 missense probably damaging 0.98
X0028:Alox5 UTSW 6 116424154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTCTTGATGGACTTGG -3'
(R):5'- TCCGACATTGAGAACTGATGG -3'

Sequencing Primer
(F):5'- ACCGTGAGCTCATCTCTGTGAG -3'
(R):5'- CGACATTGAGAACTGATGGGACTG -3'
Posted On2019-05-15