Incidental Mutation 'R0597:Rnpep'
ID55091
Institutional Source Beutler Lab
Gene Symbol Rnpep
Ensembl Gene ENSMUSG00000041926
Gene Namearginyl aminopeptidase (aminopeptidase B)
Synonyms
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R0597 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location135262712-135284084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135272419 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000076564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074357] [ENSMUST00000077340]
Predicted Effect probably benign
Transcript: ENSMUST00000074357
SMART Domains Protein: ENSMUSP00000073962
Gene: ENSMUSG00000041926

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:Peptidase_M1 31 246 2.5e-33 PFAM
Pfam:Peptidase_M1 243 378 3.1e-36 PFAM
Pfam:Peptidase_MA_2 257 402 4.5e-21 PFAM
Leuk-A4-hydro_C 461 606 1.4e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077340
AA Change: V266A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076564
Gene: ENSMUSG00000041926
AA Change: V266A

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:Peptidase_M1 31 417 2.2e-84 PFAM
Leuk-A4-hydro_C 500 645 1.4e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190632
Meta Mutation Damage Score 0.1953 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Sycp2 A C 2: 178,356,580 V1049G possibly damaging Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Rnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01789:Rnpep APN 1 135268095 missense possibly damaging 0.72
R0001:Rnpep UTSW 1 135272485 splice site probably benign
R0498:Rnpep UTSW 1 135265352 missense probably damaging 1.00
R1728:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1728:Rnpep UTSW 1 135283977 missense probably benign
R1729:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1729:Rnpep UTSW 1 135283977 missense probably benign
R1730:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1739:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1739:Rnpep UTSW 1 135283629 missense probably benign
R1762:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1783:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1783:Rnpep UTSW 1 135283977 missense probably benign
R1784:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1785:Rnpep UTSW 1 135263096 missense possibly damaging 0.95
R1785:Rnpep UTSW 1 135283977 missense probably benign
R2101:Rnpep UTSW 1 135271617 missense probably damaging 1.00
R4933:Rnpep UTSW 1 135267026 intron probably benign
R4993:Rnpep UTSW 1 135263032 missense possibly damaging 0.80
R5642:Rnpep UTSW 1 135277521 missense probably damaging 0.99
R6965:Rnpep UTSW 1 135263120 nonsense probably null
R7143:Rnpep UTSW 1 135283749 missense probably benign 0.41
R7508:Rnpep UTSW 1 135278858 missense probably benign 0.33
R8060:Rnpep UTSW 1 135266920
Z1176:Rnpep UTSW 1 135271755
Z1176:Rnpep UTSW 1 135283836
Predicted Primers PCR Primer
(F):5'- ATCCCTTTAGCAGCCTCAAGGAGC -3'
(R):5'- GGCACCTCCCAAAGGCAATCTTAG -3'

Sequencing Primer
(F):5'- TCAAGGAGCCTGGCTCATC -3'
(R):5'- GGCAATCTTAGGTTTTCATACCCAG -3'
Posted On2013-07-11