Incidental Mutation 'R7102:Anpep'
ID550913
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Namealanyl (membrane) aminopeptidase
Synonymsaminopeptidase N, Cd13, Apn
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7102 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79821803-79861059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79836313 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 554 (V554L)
Ref Sequence ENSEMBL: ENSMUSP00000035943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502]
Predicted Effect probably benign
Transcript: ENSMUST00000049004
AA Change: V554L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: V554L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107392
AA Change: V554L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: V554L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205502
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,595 T53S probably benign Het
4932438A13Rik T G 3: 36,940,798 Y990D probably damaging Het
Abca13 A T 11: 9,335,215 H3283L probably damaging Het
Abcb1a T G 5: 8,694,072 S233A probably benign Het
Actr10 T C 12: 70,953,031 probably null Het
Acvr2b C T 9: 119,432,553 A380V probably damaging Het
Adcy5 A G 16: 35,299,625 E1168G probably damaging Het
Akap12 C T 10: 4,353,226 T117I probably damaging Het
Alox5 T A 6: 116,413,468 Y516F probably benign Het
Amigo2 T C 15: 97,245,860 N227S probably damaging Het
Ap5b1 T A 19: 5,570,187 V545E possibly damaging Het
Bbs9 C T 9: 22,579,553 L326F probably damaging Het
Cadps C T 14: 12,603,738 G361R probably damaging Het
Ccdc57 C A 11: 120,921,731 E66* probably null Het
Ccr6 G A 17: 8,256,187 V75I probably benign Het
Cdk6 T C 5: 3,520,709 F300S probably damaging Het
Cenpb A C 2: 131,178,879 V333G probably damaging Het
Clca4a T C 3: 144,961,909 I434V probably benign Het
Coro2b T A 9: 62,421,385 D447V possibly damaging Het
Cpeb3 T C 19: 37,174,719 S86G probably benign Het
Cry2 C A 2: 92,413,093 A468S probably damaging Het
Csf2rb2 T C 15: 78,297,072 Y40C probably damaging Het
Ddx49 T A 8: 70,301,076 T48S probably damaging Het
Dip2c A G 13: 9,604,536 T727A probably benign Het
Ebf4 A T 2: 130,309,731 I183F probably benign Het
Elavl3 G T 9: 22,018,729 P293Q possibly damaging Het
Esyt1 A T 10: 128,516,236 L768Q probably damaging Het
Fam45a T A 19: 60,832,596 M272K probably damaging Het
Fat2 G A 11: 55,283,434 P2151L probably damaging Het
Fgfbp3 G T 19: 36,919,206 A4E possibly damaging Het
Flg T A 3: 93,293,028 V277D unknown Het
Fndc3b T C 3: 27,470,234 D459G possibly damaging Het
Fras1 A G 5: 96,571,041 Q438R probably benign Het
Glipr1l2 A T 10: 112,092,425 probably null Het
Gm7347 T A 5: 26,057,384 probably null Het
Grm6 G A 11: 50,862,977 V703I possibly damaging Het
Gtf2h1 T A 7: 46,819,126 V496E probably benign Het
Ifna12 A G 4: 88,603,151 L53P probably damaging Het
Invs T A 4: 48,407,674 S550T probably benign Het
Irak2 G T 6: 113,686,849 C453F probably damaging Het
Itih2 G T 2: 10,105,763 Q506K probably benign Het
Kidins220 T C 12: 25,057,663 I1614T probably benign Het
Krtap5-3 T A 7: 142,202,255 C276* probably null Het
Lama3 T A 18: 12,552,813 M1128K possibly damaging Het
Lhfpl4 C T 6: 113,194,145 A27T possibly damaging Het
Lyplal1 A G 1: 186,100,327 V77A probably damaging Het
Malrd1 A T 2: 16,142,303 E1985D unknown Het
Mlx A C 11: 101,088,976 Q161P probably benign Het
Mroh2b T A 15: 4,948,003 M1279K probably benign Het
Myh7b A G 2: 155,622,199 E540G probably damaging Het
Neb T A 2: 52,304,055 D653V probably damaging Het
Nek10 T A 14: 14,828,517 L113Q probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Ntpcr T A 8: 125,730,055 C5S unknown Het
Nwd1 A G 8: 72,695,329 D1001G probably damaging Het
Olfr1184 T A 2: 88,487,148 C139S probably damaging Het
Olfr294 C T 7: 86,616,267 C126Y probably benign Het
Olfr536 T A 7: 140,504,316 T48S probably benign Het
Olfr784 A C 10: 129,388,167 D178A probably damaging Het
Osbpl3 T A 6: 50,320,135 S564C probably damaging Het
Pax6 C A 2: 105,692,259 P264T probably damaging Het
Plppr4 T C 3: 117,323,183 R342G probably damaging Het
Prg4 C T 1: 150,452,254 C220Y probably damaging Het
Prune2 T A 19: 17,121,213 D1360E probably benign Het
Ranbp2 T A 10: 58,463,950 S469T probably damaging Het
Rbfox1 A T 16: 7,369,834 K43N probably benign Het
Rgs22 T C 15: 36,122,313 D25G probably damaging Het
Rnf113a2 G A 12: 84,417,771 G146S probably damaging Het
Sbpl T A 17: 23,954,634 K55* probably null Het
Scel G A 14: 103,543,832 W138* probably null Het
Scgb2b19 T C 7: 33,280,286 I12V probably null Het
Scn9a T A 2: 66,549,015 M358L probably damaging Het
Sdk2 C A 11: 113,842,690 E924* probably null Het
Sipa1l3 T C 7: 29,348,587 Q1292R possibly damaging Het
Skint4 G A 4: 112,118,101 G86D probably damaging Het
Slc28a3 C T 13: 58,588,214 V57I probably benign Het
Slc9a4 C T 1: 40,580,639 P42S probably benign Het
Slc9a4 T C 1: 40,623,399 S609P probably damaging Het
Slitrk1 T A 14: 108,912,629 T217S probably benign Het
Spindoc C T 19: 7,358,442 R327H probably benign Het
Stk36 T C 1: 74,622,223 S470P probably benign Het
Sypl C T 12: 32,974,255 P196L probably benign Het
Tekt4 T A 17: 25,474,744 I285N probably damaging Het
Tgm5 T A 2: 121,046,498 I686F possibly damaging Het
Thsd4 C A 9: 59,976,304 R933L probably damaging Het
Treml1 T A 17: 48,366,672 I237N probably damaging Het
Txndc16 T C 14: 45,205,382 I119V probably benign Het
Ubr3 C A 2: 69,897,822 N176K probably damaging Het
Vit A G 17: 78,624,997 Y511C probably damaging Het
Vwa5b2 G A 16: 20,604,234 G994D probably benign Het
Wdr63 A T 3: 146,055,704 S632R possibly damaging Het
Wnk1 T C 6: 119,948,307 T1648A unknown Het
Ythdf1 G A 2: 180,911,522 T300I probably damaging Het
Zan A G 5: 137,454,200 probably null Het
Zbbx A G 3: 75,112,094 L103P probably benign Het
Zfp105 A G 9: 122,929,804 D180G probably damaging Het
Zfp114 T A 7: 24,180,658 L144Q possibly damaging Het
Zfp128 T C 7: 12,890,472 C256R probably damaging Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79825736 missense possibly damaging 0.64
IGL00089:Anpep APN 7 79841986 missense probably damaging 1.00
IGL00767:Anpep APN 7 79840890 missense probably benign 0.00
IGL00901:Anpep APN 7 79839423 missense probably benign
IGL01919:Anpep APN 7 79825350 missense possibly damaging 0.77
IGL02049:Anpep APN 7 79835181 missense probably damaging 0.97
IGL02195:Anpep APN 7 79826685 missense probably damaging 1.00
IGL02210:Anpep APN 7 79826904 missense probably benign 0.00
IGL02584:Anpep APN 7 79825393 splice site probably benign
IGL02677:Anpep APN 7 79838730 missense probably damaging 1.00
IGL03073:Anpep APN 7 79838955 missense probably damaging 1.00
IGL03100:Anpep APN 7 79836361 missense probably benign 0.01
PIT4696001:Anpep UTSW 7 79839464 missense possibly damaging 0.85
R0329:Anpep UTSW 7 79838256 missense probably benign 0.01
R0330:Anpep UTSW 7 79838256 missense probably benign 0.01
R0619:Anpep UTSW 7 79841009 missense probably benign
R0691:Anpep UTSW 7 79839299 missense probably damaging 0.98
R1004:Anpep UTSW 7 79838256 missense probably benign 0.01
R1005:Anpep UTSW 7 79838256 missense probably benign 0.01
R1274:Anpep UTSW 7 79838256 missense probably benign 0.01
R1288:Anpep UTSW 7 79838256 missense probably benign 0.01
R1289:Anpep UTSW 7 79838256 missense probably benign 0.01
R1532:Anpep UTSW 7 79826948 nonsense probably null
R1540:Anpep UTSW 7 79838256 missense probably benign 0.01
R1574:Anpep UTSW 7 79838407 splice site probably null
R1574:Anpep UTSW 7 79838407 splice site probably null
R1618:Anpep UTSW 7 79835417 missense probably benign 0.00
R1627:Anpep UTSW 7 79842011 missense probably benign
R1693:Anpep UTSW 7 79838256 missense probably benign 0.01
R1717:Anpep UTSW 7 79838256 missense probably benign 0.01
R1745:Anpep UTSW 7 79838256 missense probably benign 0.01
R1746:Anpep UTSW 7 79838256 missense probably benign 0.01
R1748:Anpep UTSW 7 79838256 missense probably benign 0.01
R1809:Anpep UTSW 7 79841823 missense probably benign 0.01
R1901:Anpep UTSW 7 79838256 missense probably benign 0.01
R1902:Anpep UTSW 7 79838256 missense probably benign 0.01
R1903:Anpep UTSW 7 79838256 missense probably benign 0.01
R1985:Anpep UTSW 7 79840857 splice site probably null
R2379:Anpep UTSW 7 79841218 missense probably benign 0.28
R2508:Anpep UTSW 7 79838291 missense possibly damaging 0.80
R3110:Anpep UTSW 7 79841972 missense probably benign 0.15
R3112:Anpep UTSW 7 79841972 missense probably benign 0.15
R3898:Anpep UTSW 7 79839225 missense probably benign 0.07
R3899:Anpep UTSW 7 79839225 missense probably benign 0.07
R3900:Anpep UTSW 7 79839225 missense probably benign 0.07
R4211:Anpep UTSW 7 79840996 nonsense probably null
R4701:Anpep UTSW 7 79839465 missense probably benign 0.16
R4716:Anpep UTSW 7 79826632 missense probably benign 0.00
R5020:Anpep UTSW 7 79833727 missense probably benign
R5042:Anpep UTSW 7 79839469 missense probably benign 0.00
R5084:Anpep UTSW 7 79826870 critical splice donor site probably null
R5319:Anpep UTSW 7 79841731 missense probably benign
R5593:Anpep UTSW 7 79842046 missense probably benign 0.04
R5778:Anpep UTSW 7 79836391 missense probably benign 0.00
R5852:Anpep UTSW 7 79838972 nonsense probably null
R5906:Anpep UTSW 7 79833675 missense probably benign
R6164:Anpep UTSW 7 79842205 missense possibly damaging 0.68
R6254:Anpep UTSW 7 79839233 missense probably damaging 1.00
R6284:Anpep UTSW 7 79825802 missense probably damaging 1.00
R6380:Anpep UTSW 7 79841896 missense probably benign 0.04
R6594:Anpep UTSW 7 79841361 splice site probably null
R6746:Anpep UTSW 7 79839185 splice site probably null
R6920:Anpep UTSW 7 79825349 missense probably damaging 1.00
R7060:Anpep UTSW 7 79841794 missense probably benign 0.33
R7072:Anpep UTSW 7 79835379 missense possibly damaging 0.58
R7095:Anpep UTSW 7 79842202 missense possibly damaging 0.87
R7178:Anpep UTSW 7 79840988 missense probably benign
R7223:Anpep UTSW 7 79825310 missense probably damaging 1.00
R7344:Anpep UTSW 7 79838650 missense possibly damaging 0.60
R7441:Anpep UTSW 7 79827644 missense possibly damaging 0.93
R7479:Anpep UTSW 7 79835370 missense probably benign 0.11
R7503:Anpep UTSW 7 79826637 missense probably damaging 1.00
R7683:Anpep UTSW 7 79839198 missense probably damaging 0.98
R7912:Anpep UTSW 7 79838426 missense probably benign 0.00
R7935:Anpep UTSW 7 79826961 missense possibly damaging 0.46
R8036:Anpep UTSW 7 79841898 missense probably benign 0.11
R8039:Anpep UTSW 7 79839400 critical splice donor site probably null
R8470:Anpep UTSW 7 79839521 missense probably benign 0.16
R8549:Anpep UTSW 7 79840896 missense probably benign 0.00
R8723:Anpep UTSW 7 79838938 missense probably damaging 1.00
R8726:Anpep UTSW 7 79840893 missense probably benign 0.00
Z1176:Anpep UTSW 7 79827639 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATCGGTTACTCTTGGGCAC -3'
(R):5'- TCCAGAATCTGCAGAGGCTACC -3'

Sequencing Primer
(F):5'- GATGGCCCAACACTGATATCAAGTG -3'
(R):5'- TGCAGAGGCTACCTGGGTG -3'
Posted On2019-05-15