Incidental Mutation 'R7102:Thsd4'
ID550922
Institutional Source Beutler Lab
Gene Symbol Thsd4
Ensembl Gene ENSMUSG00000032289
Gene Namethrombospondin, type I, domain containing 4
SynonymsADAMTSL6, B230114P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7102 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location59966931-60522046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59976304 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 933 (R933L)
Ref Sequence ENSEMBL: ENSMUSP00000096257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034829] [ENSMUST00000098660] [ENSMUST00000171654]
Predicted Effect probably damaging
Transcript: ENSMUST00000034829
AA Change: R573L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034829
Gene: ENSMUSG00000032289
AA Change: R573L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ADAM_spacer1 52 168 7.8e-40 PFAM
low complexity region 189 205 N/A INTRINSIC
TSP1 261 317 1.51e-1 SMART
TSP1 319 377 8.11e-5 SMART
TSP1 379 434 7.92e-8 SMART
TSP1 436 491 1.6e-3 SMART
TSP1 495 553 4.82e-2 SMART
TSP1 556 608 1.03e-6 SMART
Pfam:PLAC 614 646 2.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098660
AA Change: R933L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096257
Gene: ENSMUSG00000032289
AA Change: R933L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 1.5e-39 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 974 1006 4.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171654
AA Change: R933L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131418
Gene: ENSMUSG00000032289
AA Change: R933L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 5.4e-40 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 975 1005 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,595 T53S probably benign Het
4932438A13Rik T G 3: 36,940,798 Y990D probably damaging Het
Abca13 A T 11: 9,335,215 H3283L probably damaging Het
Abcb1a T G 5: 8,694,072 S233A probably benign Het
Actr10 T C 12: 70,953,031 probably null Het
Acvr2b C T 9: 119,432,553 A380V probably damaging Het
Adcy5 A G 16: 35,299,625 E1168G probably damaging Het
Akap12 C T 10: 4,353,226 T117I probably damaging Het
Alox5 T A 6: 116,413,468 Y516F probably benign Het
Amigo2 T C 15: 97,245,860 N227S probably damaging Het
Anpep C A 7: 79,836,313 V554L probably benign Het
Ap5b1 T A 19: 5,570,187 V545E possibly damaging Het
Bbs9 C T 9: 22,579,553 L326F probably damaging Het
Cadps C T 14: 12,603,738 G361R probably damaging Het
Ccdc57 C A 11: 120,921,731 E66* probably null Het
Ccr6 G A 17: 8,256,187 V75I probably benign Het
Cdk6 T C 5: 3,520,709 F300S probably damaging Het
Cenpb A C 2: 131,178,879 V333G probably damaging Het
Clca4a T C 3: 144,961,909 I434V probably benign Het
Coro2b T A 9: 62,421,385 D447V possibly damaging Het
Cpeb3 T C 19: 37,174,719 S86G probably benign Het
Cry2 C A 2: 92,413,093 A468S probably damaging Het
Csf2rb2 T C 15: 78,297,072 Y40C probably damaging Het
Ddx49 T A 8: 70,301,076 T48S probably damaging Het
Dip2c A G 13: 9,604,536 T727A probably benign Het
Ebf4 A T 2: 130,309,731 I183F probably benign Het
Elavl3 G T 9: 22,018,729 P293Q possibly damaging Het
Esyt1 A T 10: 128,516,236 L768Q probably damaging Het
Fam45a T A 19: 60,832,596 M272K probably damaging Het
Fat2 G A 11: 55,283,434 P2151L probably damaging Het
Fgfbp3 G T 19: 36,919,206 A4E possibly damaging Het
Flg T A 3: 93,293,028 V277D unknown Het
Fndc3b T C 3: 27,470,234 D459G possibly damaging Het
Fras1 A G 5: 96,571,041 Q438R probably benign Het
Glipr1l2 A T 10: 112,092,425 probably null Het
Gm7347 T A 5: 26,057,384 probably null Het
Grm6 G A 11: 50,862,977 V703I possibly damaging Het
Gtf2h1 T A 7: 46,819,126 V496E probably benign Het
Ifna12 A G 4: 88,603,151 L53P probably damaging Het
Invs T A 4: 48,407,674 S550T probably benign Het
Irak2 G T 6: 113,686,849 C453F probably damaging Het
Itih2 G T 2: 10,105,763 Q506K probably benign Het
Kidins220 T C 12: 25,057,663 I1614T probably benign Het
Krtap5-3 T A 7: 142,202,255 C276* probably null Het
Lama3 T A 18: 12,552,813 M1128K possibly damaging Het
Lhfpl4 C T 6: 113,194,145 A27T possibly damaging Het
Lyplal1 A G 1: 186,100,327 V77A probably damaging Het
Malrd1 A T 2: 16,142,303 E1985D unknown Het
Mlx A C 11: 101,088,976 Q161P probably benign Het
Mroh2b T A 15: 4,948,003 M1279K probably benign Het
Myh7b A G 2: 155,622,199 E540G probably damaging Het
Neb T A 2: 52,304,055 D653V probably damaging Het
Nek10 T A 14: 14,828,517 L113Q probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Ntpcr T A 8: 125,730,055 C5S unknown Het
Nwd1 A G 8: 72,695,329 D1001G probably damaging Het
Olfr1184 T A 2: 88,487,148 C139S probably damaging Het
Olfr294 C T 7: 86,616,267 C126Y probably benign Het
Olfr536 T A 7: 140,504,316 T48S probably benign Het
Olfr784 A C 10: 129,388,167 D178A probably damaging Het
Osbpl3 T A 6: 50,320,135 S564C probably damaging Het
Pax6 C A 2: 105,692,259 P264T probably damaging Het
Plppr4 T C 3: 117,323,183 R342G probably damaging Het
Prg4 C T 1: 150,452,254 C220Y probably damaging Het
Prune2 T A 19: 17,121,213 D1360E probably benign Het
Ranbp2 T A 10: 58,463,950 S469T probably damaging Het
Rbfox1 A T 16: 7,369,834 K43N probably benign Het
Rgs22 T C 15: 36,122,313 D25G probably damaging Het
Rnf113a2 G A 12: 84,417,771 G146S probably damaging Het
Sbpl T A 17: 23,954,634 K55* probably null Het
Scel G A 14: 103,543,832 W138* probably null Het
Scgb2b19 T C 7: 33,280,286 I12V probably null Het
Scn9a T A 2: 66,549,015 M358L probably damaging Het
Sdk2 C A 11: 113,842,690 E924* probably null Het
Sipa1l3 T C 7: 29,348,587 Q1292R possibly damaging Het
Skint4 G A 4: 112,118,101 G86D probably damaging Het
Slc28a3 C T 13: 58,588,214 V57I probably benign Het
Slc9a4 C T 1: 40,580,639 P42S probably benign Het
Slc9a4 T C 1: 40,623,399 S609P probably damaging Het
Slitrk1 T A 14: 108,912,629 T217S probably benign Het
Spindoc C T 19: 7,358,442 R327H probably benign Het
Stk36 T C 1: 74,622,223 S470P probably benign Het
Sypl C T 12: 32,974,255 P196L probably benign Het
Tekt4 T A 17: 25,474,744 I285N probably damaging Het
Tgm5 T A 2: 121,046,498 I686F possibly damaging Het
Treml1 T A 17: 48,366,672 I237N probably damaging Het
Txndc16 T C 14: 45,205,382 I119V probably benign Het
Ubr3 C A 2: 69,897,822 N176K probably damaging Het
Vit A G 17: 78,624,997 Y511C probably damaging Het
Vwa5b2 G A 16: 20,604,234 G994D probably benign Het
Wdr63 A T 3: 146,055,704 S632R possibly damaging Het
Wnk1 T C 6: 119,948,307 T1648A unknown Het
Ythdf1 G A 2: 180,911,522 T300I probably damaging Het
Zan A G 5: 137,454,200 probably null Het
Zbbx A G 3: 75,112,094 L103P probably benign Het
Zfp105 A G 9: 122,929,804 D180G probably damaging Het
Zfp114 T A 7: 24,180,658 L144Q possibly damaging Het
Zfp128 T C 7: 12,890,472 C256R probably damaging Het
Other mutations in Thsd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Thsd4 APN 9 60394115 missense probably benign 0.22
IGL02418:Thsd4 APN 9 60428315 missense probably damaging 0.99
IGL02491:Thsd4 APN 9 60000018 missense probably damaging 0.99
IGL02754:Thsd4 APN 9 59989097 splice site probably benign
IGL02874:Thsd4 APN 9 60252730 missense probably damaging 1.00
IGL02978:Thsd4 APN 9 60056846 splice site probably null
IGL03139:Thsd4 APN 9 59997173 missense probably benign 0.01
R0266:Thsd4 UTSW 9 59997134 missense probably benign 0.07
R0482:Thsd4 UTSW 9 60002978 missense probably damaging 1.00
R1188:Thsd4 UTSW 9 60394406 missense probably benign 0.12
R1447:Thsd4 UTSW 9 59997213 missense probably benign
R1572:Thsd4 UTSW 9 60394553 splice site probably benign
R1812:Thsd4 UTSW 9 60056937 missense probably damaging 1.00
R2349:Thsd4 UTSW 9 59972515 missense probably benign 0.05
R3236:Thsd4 UTSW 9 60394387 missense probably benign
R4088:Thsd4 UTSW 9 59997222 missense probably benign 0.02
R4884:Thsd4 UTSW 9 59988037 missense probably benign 0.43
R4886:Thsd4 UTSW 9 59989030 missense probably benign 0.00
R5066:Thsd4 UTSW 9 59976332 missense probably damaging 1.00
R5223:Thsd4 UTSW 9 60057042 missense probably damaging 1.00
R5441:Thsd4 UTSW 9 59979783 missense probably damaging 1.00
R5457:Thsd4 UTSW 9 59979777 missense probably damaging 1.00
R5574:Thsd4 UTSW 9 59972400 missense probably damaging 1.00
R5581:Thsd4 UTSW 9 59972458 missense possibly damaging 0.90
R5903:Thsd4 UTSW 9 60394106 missense possibly damaging 0.47
R6220:Thsd4 UTSW 9 59982747 missense probably damaging 1.00
R6728:Thsd4 UTSW 9 59997197 missense probably benign
R7316:Thsd4 UTSW 9 59987359 missense probably benign 0.00
R7403:Thsd4 UTSW 9 60056887 missense probably damaging 0.99
R7638:Thsd4 UTSW 9 60394472 missense probably damaging 1.00
R7671:Thsd4 UTSW 9 60428174 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTGGATAACTTGACAGAGTG -3'
(R):5'- TGGTGGGAGACTAGAATTCACTC -3'

Sequencing Primer
(F):5'- CAGAGTGAGAGGGGGCTCATTTC -3'
(R):5'- TGGGAGACTAGAATTCACTCAGAACC -3'
Posted On2019-05-15