Incidental Mutation 'R7102:Nek10'
ID550944
Institutional Source Beutler Lab
Gene Symbol Nek10
Ensembl Gene ENSMUSG00000042567
Gene NameNIMA (never in mitosis gene a)- related kinase 10
SynonymsLOC238944
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7102 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location14803415-15012059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14828517 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 113 (L113Q)
Ref Sequence ENSEMBL: ENSMUSP00000108249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112630] [ENSMUST00000112631] [ENSMUST00000224491]
Predicted Effect probably damaging
Transcript: ENSMUST00000112630
AA Change: L113Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108249
Gene: ENSMUSG00000042567
AA Change: L113Q

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112631
AA Change: L113Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108250
Gene: ENSMUSG00000042567
AA Change: L113Q

DomainStartEndE-ValueType
ARM 197 238 8.23e1 SMART
ARM 278 320 5.18e0 SMART
low complexity region 387 400 N/A INTRINSIC
ARM 401 448 7.09e1 SMART
S_TKc 519 791 2.36e-75 SMART
low complexity region 799 811 N/A INTRINSIC
low complexity region 839 863 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224491
AA Change: L113Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik T A 19: 5,503,595 T53S probably benign Het
4932438A13Rik T G 3: 36,940,798 Y990D probably damaging Het
Abca13 A T 11: 9,335,215 H3283L probably damaging Het
Abcb1a T G 5: 8,694,072 S233A probably benign Het
Actr10 T C 12: 70,953,031 probably null Het
Acvr2b C T 9: 119,432,553 A380V probably damaging Het
Adcy5 A G 16: 35,299,625 E1168G probably damaging Het
Akap12 C T 10: 4,353,226 T117I probably damaging Het
Alox5 T A 6: 116,413,468 Y516F probably benign Het
Amigo2 T C 15: 97,245,860 N227S probably damaging Het
Anpep C A 7: 79,836,313 V554L probably benign Het
Ap5b1 T A 19: 5,570,187 V545E possibly damaging Het
Bbs9 C T 9: 22,579,553 L326F probably damaging Het
Cadps C T 14: 12,603,738 G361R probably damaging Het
Ccdc57 C A 11: 120,921,731 E66* probably null Het
Ccr6 G A 17: 8,256,187 V75I probably benign Het
Cdk6 T C 5: 3,520,709 F300S probably damaging Het
Cenpb A C 2: 131,178,879 V333G probably damaging Het
Clca4a T C 3: 144,961,909 I434V probably benign Het
Coro2b T A 9: 62,421,385 D447V possibly damaging Het
Cpeb3 T C 19: 37,174,719 S86G probably benign Het
Cry2 C A 2: 92,413,093 A468S probably damaging Het
Csf2rb2 T C 15: 78,297,072 Y40C probably damaging Het
Ddx49 T A 8: 70,301,076 T48S probably damaging Het
Dip2c A G 13: 9,604,536 T727A probably benign Het
Ebf4 A T 2: 130,309,731 I183F probably benign Het
Elavl3 G T 9: 22,018,729 P293Q possibly damaging Het
Esyt1 A T 10: 128,516,236 L768Q probably damaging Het
Fam45a T A 19: 60,832,596 M272K probably damaging Het
Fat2 G A 11: 55,283,434 P2151L probably damaging Het
Fgfbp3 G T 19: 36,919,206 A4E possibly damaging Het
Flg T A 3: 93,293,028 V277D unknown Het
Fndc3b T C 3: 27,470,234 D459G possibly damaging Het
Fras1 A G 5: 96,571,041 Q438R probably benign Het
Glipr1l2 A T 10: 112,092,425 probably null Het
Gm7347 T A 5: 26,057,384 probably null Het
Grm6 G A 11: 50,862,977 V703I possibly damaging Het
Gtf2h1 T A 7: 46,819,126 V496E probably benign Het
Ifna12 A G 4: 88,603,151 L53P probably damaging Het
Invs T A 4: 48,407,674 S550T probably benign Het
Irak2 G T 6: 113,686,849 C453F probably damaging Het
Itih2 G T 2: 10,105,763 Q506K probably benign Het
Kidins220 T C 12: 25,057,663 I1614T probably benign Het
Krtap5-3 T A 7: 142,202,255 C276* probably null Het
Lama3 T A 18: 12,552,813 M1128K possibly damaging Het
Lhfpl4 C T 6: 113,194,145 A27T possibly damaging Het
Lyplal1 A G 1: 186,100,327 V77A probably damaging Het
Malrd1 A T 2: 16,142,303 E1985D unknown Het
Mlx A C 11: 101,088,976 Q161P probably benign Het
Mroh2b T A 15: 4,948,003 M1279K probably benign Het
Myh7b A G 2: 155,622,199 E540G probably damaging Het
Neb T A 2: 52,304,055 D653V probably damaging Het
Nlrp4c T A 7: 6,065,709 L203* probably null Het
Ntpcr T A 8: 125,730,055 C5S unknown Het
Nwd1 A G 8: 72,695,329 D1001G probably damaging Het
Olfr1184 T A 2: 88,487,148 C139S probably damaging Het
Olfr294 C T 7: 86,616,267 C126Y probably benign Het
Olfr536 T A 7: 140,504,316 T48S probably benign Het
Olfr784 A C 10: 129,388,167 D178A probably damaging Het
Osbpl3 T A 6: 50,320,135 S564C probably damaging Het
Pax6 C A 2: 105,692,259 P264T probably damaging Het
Plppr4 T C 3: 117,323,183 R342G probably damaging Het
Prg4 C T 1: 150,452,254 C220Y probably damaging Het
Prune2 T A 19: 17,121,213 D1360E probably benign Het
Ranbp2 T A 10: 58,463,950 S469T probably damaging Het
Rbfox1 A T 16: 7,369,834 K43N probably benign Het
Rgs22 T C 15: 36,122,313 D25G probably damaging Het
Rnf113a2 G A 12: 84,417,771 G146S probably damaging Het
Sbpl T A 17: 23,954,634 K55* probably null Het
Scel G A 14: 103,543,832 W138* probably null Het
Scgb2b19 T C 7: 33,280,286 I12V probably null Het
Scn9a T A 2: 66,549,015 M358L probably damaging Het
Sdk2 C A 11: 113,842,690 E924* probably null Het
Sipa1l3 T C 7: 29,348,587 Q1292R possibly damaging Het
Skint4 G A 4: 112,118,101 G86D probably damaging Het
Slc28a3 C T 13: 58,588,214 V57I probably benign Het
Slc9a4 C T 1: 40,580,639 P42S probably benign Het
Slc9a4 T C 1: 40,623,399 S609P probably damaging Het
Slitrk1 T A 14: 108,912,629 T217S probably benign Het
Spindoc C T 19: 7,358,442 R327H probably benign Het
Stk36 T C 1: 74,622,223 S470P probably benign Het
Sypl C T 12: 32,974,255 P196L probably benign Het
Tekt4 T A 17: 25,474,744 I285N probably damaging Het
Tgm5 T A 2: 121,046,498 I686F possibly damaging Het
Thsd4 C A 9: 59,976,304 R933L probably damaging Het
Treml1 T A 17: 48,366,672 I237N probably damaging Het
Txndc16 T C 14: 45,205,382 I119V probably benign Het
Ubr3 C A 2: 69,897,822 N176K probably damaging Het
Vit A G 17: 78,624,997 Y511C probably damaging Het
Vwa5b2 G A 16: 20,604,234 G994D probably benign Het
Wdr63 A T 3: 146,055,704 S632R possibly damaging Het
Wnk1 T C 6: 119,948,307 T1648A unknown Het
Ythdf1 G A 2: 180,911,522 T300I probably damaging Het
Zan A G 5: 137,454,200 probably null Het
Zbbx A G 3: 75,112,094 L103P probably benign Het
Zfp105 A G 9: 122,929,804 D180G probably damaging Het
Zfp114 T A 7: 24,180,658 L144Q possibly damaging Het
Zfp128 T C 7: 12,890,472 C256R probably damaging Het
Other mutations in Nek10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Nek10 APN 14 14850957 missense probably damaging 0.99
IGL02067:Nek10 APN 14 14861639 missense probably benign 0.12
IGL02361:Nek10 APN 14 14843856 missense probably damaging 1.00
IGL02687:Nek10 APN 14 14840570 missense probably damaging 1.00
IGL02929:Nek10 APN 14 14821119 missense possibly damaging 0.82
IGL03229:Nek10 APN 14 14986686 missense probably benign 0.10
P0041:Nek10 UTSW 14 14861603 missense probably benign 0.01
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0007:Nek10 UTSW 14 14840574 missense probably benign 0.10
R0142:Nek10 UTSW 14 14861560 missense possibly damaging 0.96
R0433:Nek10 UTSW 14 14860927 missense probably benign 0.32
R0633:Nek10 UTSW 14 14857782 critical splice acceptor site probably null
R1087:Nek10 UTSW 14 14827059 missense possibly damaging 0.59
R1184:Nek10 UTSW 14 14931325 splice site probably benign
R1250:Nek10 UTSW 14 14853887 missense probably damaging 1.00
R1371:Nek10 UTSW 14 14850983 missense probably damaging 0.98
R1506:Nek10 UTSW 14 14999078 splice site probably benign
R1829:Nek10 UTSW 14 14863454 critical splice acceptor site probably null
R1831:Nek10 UTSW 14 14842789 missense probably benign
R1833:Nek10 UTSW 14 14842789 missense probably benign
R1990:Nek10 UTSW 14 14860764 missense probably benign
R1997:Nek10 UTSW 14 14827003 missense probably benign 0.09
R2011:Nek10 UTSW 14 14885122 missense probably damaging 1.00
R2158:Nek10 UTSW 14 14885047 splice site probably null
R2288:Nek10 UTSW 14 14853956 nonsense probably null
R2568:Nek10 UTSW 14 14999112 missense possibly damaging 0.89
R2907:Nek10 UTSW 14 14980613 missense possibly damaging 0.81
R2965:Nek10 UTSW 14 14836202 missense probably damaging 1.00
R3922:Nek10 UTSW 14 14861585 missense possibly damaging 0.88
R4032:Nek10 UTSW 14 14853877 synonymous probably null
R4700:Nek10 UTSW 14 14842841 missense possibly damaging 0.69
R4742:Nek10 UTSW 14 14861624 missense probably null 0.03
R4785:Nek10 UTSW 14 14855714 missense probably benign
R4890:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4891:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4920:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4924:Nek10 UTSW 14 14846594 splice site probably null
R4928:Nek10 UTSW 14 14930577 missense probably damaging 1.00
R4948:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4952:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R4953:Nek10 UTSW 14 14860986 missense possibly damaging 0.47
R5092:Nek10 UTSW 14 14820851 missense possibly damaging 0.81
R5097:Nek10 UTSW 14 14857851 missense probably benign 0.00
R5593:Nek10 UTSW 14 14980544 nonsense probably null
R5696:Nek10 UTSW 14 14860736 splice site probably null
R5813:Nek10 UTSW 14 14986704 missense probably benign 0.01
R5829:Nek10 UTSW 14 14865404 missense probably damaging 1.00
R5872:Nek10 UTSW 14 14850896 missense probably benign 0.06
R5939:Nek10 UTSW 14 14931290 missense possibly damaging 0.58
R6025:Nek10 UTSW 14 14865633 missense probably benign 0.41
R6235:Nek10 UTSW 14 14821113 nonsense probably null
R6539:Nek10 UTSW 14 14860789 missense possibly damaging 0.94
R6542:Nek10 UTSW 14 14999108 missense probably benign 0.44
R6561:Nek10 UTSW 14 14828448 missense possibly damaging 0.48
R6659:Nek10 UTSW 14 14861684 missense probably benign 0.29
R7039:Nek10 UTSW 14 14826946 missense possibly damaging 0.63
R7039:Nek10 UTSW 14 14986700 missense probably damaging 0.99
R7185:Nek10 UTSW 14 14846621 missense probably benign 0.03
R7198:Nek10 UTSW 14 14850947 missense probably damaging 0.99
R7202:Nek10 UTSW 14 14836171 missense probably benign 0.01
R7251:Nek10 UTSW 14 14853965 missense probably benign
R7345:Nek10 UTSW 14 14955503 missense probably benign
R7590:Nek10 UTSW 14 15006693 makesense probably null
R7593:Nek10 UTSW 14 14826955 missense probably benign 0.04
R7616:Nek10 UTSW 14 14937759 missense probably benign 0.27
R7635:Nek10 UTSW 14 14850932 missense probably benign 0.01
R7817:Nek10 UTSW 14 15001017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTGACCTTCAGACTCTCAATG -3'
(R):5'- AGGTCCAACAAGAGATTCCAATG -3'

Sequencing Primer
(F):5'- GACCTTCAGACTCTCAATGTTTTGTG -3'
(R):5'- GAGATTCCAATGAGAACACAGC -3'
Posted On2019-05-15