Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Kif1a'

550968

Institutional Source

Beutler Lab

Gene Symbol

Kif1a

Ensembl Gene

ENSMUSG00000014602

Gene Name

kinesin family member 1A

Synonyms

LOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1

MMRRC Submission

Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Essential gene?

Probably essential (E-score: 0.808) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93015464-93101951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93077785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 89 (Y89C)

Ref Sequence

ENSEMBL: ENSMUSP00000128432 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000186861] [ENSMUST00000190723]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000086819
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: Y89C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	411	429	N/A	INTRINSIC
FHA	524	581	1.39e-8	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	6.4e-13	PFAM
Pfam:DUF3694	1157	1305	1.8e-47	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112958
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: Y89C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	851	3.9e-15	PFAM
Pfam:DUF3694	1148	1304	5e-40	PFAM
low complexity region	1420	1444	N/A	INTRINSIC
low complexity region	1541	1549	N/A	INTRINSIC
PH	1584	1683	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171556
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: Y89C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	2.7e-13	PFAM
Pfam:DUF3694	1148	1296	8.4e-48	PFAM
low complexity region	1411	1435	N/A	INTRINSIC
low complexity region	1532	1540	N/A	INTRINSIC
PH	1575	1674	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171796
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: Y89C

Domain	Start	End	E-Value	Type
KISc	3	362	1.05e-177	SMART
low complexity region	402	420	N/A	INTRINSIC
FHA	515	572	1.39e-8	SMART
coiled coil region	625	679	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
low complexity region	753	769	N/A	INTRINSIC
Pfam:KIF1B	805	852	6.4e-13	PFAM
Pfam:DUF3694	1148	1304	1.8e-46	PFAM
low complexity region	1419	1443	N/A	INTRINSIC
low complexity region	1540	1548	N/A	INTRINSIC
PH	1583	1682	1.52e-13	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186861
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141194
Gene: ENSMUSG00000014602
AA Change: Y89C

Domain	Start	End	E-Value	Type
KISc	3	109	9.7e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190723
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: Y89C

Domain	Start	End	E-Value	Type
KISc	3	362	5.2e-180	SMART
low complexity region	411	429	N/A	INTRINSIC
coiled coil region	438	471	N/A	INTRINSIC
FHA	524	581	6.9e-11	SMART
coiled coil region	634	688	N/A	INTRINSIC
low complexity region	693	706	N/A	INTRINSIC
low complexity region	762	778	N/A	INTRINSIC
Pfam:KIF1B	814	861	4e-10	PFAM
low complexity region	885	900	N/A	INTRINSIC
coiled coil region	901	929	N/A	INTRINSIC
internal_repeat_1	938	957	5.9e-5	PROSPERO
Pfam:DUF3694	1250	1398	1.1e-44	PFAM
low complexity region	1513	1537	N/A	INTRINSIC
low complexity region	1634	1642	N/A	INTRINSIC
PH	1677	1776	6.9e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Kif1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kif1a	APN	1	93054934	missense	probably damaging	1.00
IGL01574:Kif1a	APN	1	93082340	missense	probably damaging	1.00
IGL01637:Kif1a	APN	1	93039853	missense	possibly damaging	0.95
IGL01895:Kif1a	APN	1	93025733	missense	possibly damaging	0.65
IGL02215:Kif1a	APN	1	93020549	missense	probably benign	0.05
IGL02571:Kif1a	APN	1	93020456	critical splice donor site	probably null
IGL02734:Kif1a	APN	1	93062558	missense	probably damaging	1.00
IGL02752:Kif1a	APN	1	93039847	missense	possibly damaging	0.92
IGL02990:Kif1a	APN	1	93039263	missense	probably damaging	1.00
IGL03298:Kif1a	APN	1	93066181	missense	probably damaging	1.00
IGL03309:Kif1a	APN	1	93058857	nonsense	probably null
IGL03354:Kif1a	APN	1	93060235	missense	probably damaging	1.00
asbestos	UTSW	1	93022505	missense	probably damaging	1.00
chrysolite	UTSW	1	93074948	splice site	probably benign
osmium	UTSW	1	93058810	splice site	probably benign
R4538_Kif1a_397	UTSW	1	93077047	missense	probably damaging	1.00
1mM(1):Kif1a	UTSW	1	93077068	missense	probably benign	0.00
IGL03046:Kif1a	UTSW	1	93082406	missense	probably damaging	1.00
PIT4508001:Kif1a	UTSW	1	93046729	missense	probably damaging	1.00
R0025:Kif1a	UTSW	1	93042358	missense	probably damaging	1.00
R0115:Kif1a	UTSW	1	93046778	splice site	probably benign
R0243:Kif1a	UTSW	1	93042093	missense	probably damaging	1.00
R0270:Kif1a	UTSW	1	93054442	splice site	probably benign
R0335:Kif1a	UTSW	1	93052566	splice site	probably benign
R0380:Kif1a	UTSW	1	93056031	critical splice acceptor site	probably null
R0472:Kif1a	UTSW	1	93018997	missense	probably damaging	0.99
R0501:Kif1a	UTSW	1	93056245	missense	probably damaging	1.00
R0538:Kif1a	UTSW	1	93043638	missense	probably damaging	0.99
R0628:Kif1a	UTSW	1	93019883	missense	probably damaging	1.00
R0848:Kif1a	UTSW	1	93019898	missense	probably damaging	1.00
R1110:Kif1a	UTSW	1	93023453	splice site	probably benign
R1132:Kif1a	UTSW	1	93056021	missense	probably damaging	0.99
R1387:Kif1a	UTSW	1	93055950	splice site	probably benign
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1466:Kif1a	UTSW	1	93054929	missense	possibly damaging	0.68
R1544:Kif1a	UTSW	1	93074948	splice site	probably benign
R1569:Kif1a	UTSW	1	93058810	splice site	probably benign
R1802:Kif1a	UTSW	1	93066149	missense	probably damaging	1.00
R1917:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1919:Kif1a	UTSW	1	93019031	missense	possibly damaging	0.95
R1999:Kif1a	UTSW	1	93060795	missense	probably damaging	0.98
R2000:Kif1a	UTSW	1	93054329	missense	probably damaging	0.99
R2276:Kif1a	UTSW	1	93068477	splice site	probably benign
R2307:Kif1a	UTSW	1	93078769	missense	probably damaging	1.00
R2919:Kif1a	UTSW	1	93046742	missense	probably damaging	1.00
R3440:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3441:Kif1a	UTSW	1	93036853	missense	possibly damaging	0.53
R3618:Kif1a	UTSW	1	93077043	missense	probably null	1.00
R3957:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R4010:Kif1a	UTSW	1	93022409	missense	probably benign	0.42
R4013:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4017:Kif1a	UTSW	1	93076292	missense	probably damaging	1.00
R4115:Kif1a	UTSW	1	93052538	missense	probably damaging	1.00
R4386:Kif1a	UTSW	1	93068550	missense	probably damaging	1.00
R4538:Kif1a	UTSW	1	93077047	missense	probably damaging	1.00
R4608:Kif1a	UTSW	1	93024646	missense	possibly damaging	0.81
R4625:Kif1a	UTSW	1	93042659	missense	probably benign	0.00
R4701:Kif1a	UTSW	1	93078835	missense	probably damaging	0.99
R4794:Kif1a	UTSW	1	93025727	missense	probably damaging	1.00
R4830:Kif1a	UTSW	1	93021209	splice site	probably null
R4903:Kif1a	UTSW	1	93021734	missense	probably damaging	1.00
R4915:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4918:Kif1a	UTSW	1	93074978	missense	probably benign	0.21
R4991:Kif1a	UTSW	1	93078808	missense	probably benign	0.00
R5028:Kif1a	UTSW	1	93054327	missense	possibly damaging	0.68
R5051:Kif1a	UTSW	1	93076154	splice site	probably null
R5073:Kif1a	UTSW	1	93022505	missense	probably damaging	1.00
R5103:Kif1a	UTSW	1	93046696	missense	probably damaging	1.00
R5314:Kif1a	UTSW	1	93018498	missense	probably damaging	1.00
R5481:Kif1a	UTSW	1	93060244	missense	probably benign	0.01
R5510:Kif1a	UTSW	1	93041692	missense	possibly damaging	0.93
R5610:Kif1a	UTSW	1	93025728	missense	probably damaging	1.00
R5643:Kif1a	UTSW	1	93055767	missense	probably damaging	0.98
R5808:Kif1a	UTSW	1	93042698	missense	probably damaging	0.99
R6027:Kif1a	UTSW	1	93025643	missense	probably benign	0.33
R6056:Kif1a	UTSW	1	93024648	missense	probably damaging	1.00
R6077:Kif1a	UTSW	1	93054896	missense	possibly damaging	0.54
R6120:Kif1a	UTSW	1	93024574	splice site	probably null
R6126:Kif1a	UTSW	1	93019899	missense	probably damaging	1.00
R6130:Kif1a	UTSW	1	93036901	missense	probably damaging	1.00
R6255:Kif1a	UTSW	1	93019983	missense	probably damaging	1.00
R6301:Kif1a	UTSW	1	93054941	nonsense	probably null
R6326:Kif1a	UTSW	1	93076326	missense	probably damaging	1.00
R6594:Kif1a	UTSW	1	93021313	missense	probably benign	0.00
R6653:Kif1a	UTSW	1	93077698	missense	probably damaging	1.00
R6791:Kif1a	UTSW	1	93066137	missense	probably damaging	1.00
R6853:Kif1a	UTSW	1	93039802	missense	possibly damaging	0.47
R7022:Kif1a	UTSW	1	93066098	missense	probably benign	0.31
R7059:Kif1a	UTSW	1	93046829	intron	probably benign
R7248:Kif1a	UTSW	1	93041583	missense	probably benign	0.35
R7259:Kif1a	UTSW	1	93073810	nonsense	probably null
R7424:Kif1a	UTSW	1	93054317	missense	possibly damaging	0.89
R7659:Kif1a	UTSW	1	93046820	intron	probably benign
R7681:Kif1a	UTSW	1	93054944	missense	probably benign
R7976:Kif1a	UTSW	1	93039774	missense	probably damaging	1.00
R8056:Kif1a	UTSW	1	93054701	intron	probably benign
R8420:Kif1a	UTSW	1	93022419	missense	probably benign
R8994:Kif1a	UTSW	1	93055735	missense	possibly damaging	0.77
R9016:Kif1a	UTSW	1	93025673	missense	probably damaging	1.00
R9206:Kif1a	UTSW	1	93051480	missense	probably damaging	0.99
R9246:Kif1a	UTSW	1	93077779	missense	probably damaging	0.98
R9252:Kif1a	UTSW	1	93075054	missense	probably damaging	1.00
R9388:Kif1a	UTSW	1	93072307	critical splice donor site	probably null
R9413:Kif1a	UTSW	1	93021297	missense	probably benign	0.00
R9612:Kif1a	UTSW	1	93025694	missense	probably damaging	1.00
R9621:Kif1a	UTSW	1	93055723	missense	probably benign
R9625:Kif1a	UTSW	1	93073044	missense	probably benign	0.42
R9694:Kif1a	UTSW	1	93022451	missense	probably benign
Z1176:Kif1a	UTSW	1	93021316	missense	probably damaging	0.97
Z1176:Kif1a	UTSW	1	93022491	missense	probably damaging	1.00
Z1176:Kif1a	UTSW	1	93055697	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCAAAGACTGGCCTCCTGC -3'
(R):5'- TGTACCATAGCACAGCTTTTCAC -3'

Sequencing Primer
(F):5'- GGCCTCCTGCAACCCATC -3'
(R):5'- TAGCACAGCTTTTCACCTCAAGG -3'

Posted On

2019-05-15