Incidental Mutation 'R7103:Mindy3'
ID 550970
Institutional Source Beutler Lab
Gene Symbol Mindy3
Ensembl Gene ENSMUSG00000026767
Gene Name MINDY lysine 48 deubiquitinase 3
Synonyms 1810041E18Rik, 2310047O13Rik, 5830410F13Rik, Fam188a
MMRRC Submission 045195-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R7103 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 12352074-12424281 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 12405885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 137 (A137S)
Ref Sequence ENSEMBL: ENSMUSP00000028105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028105] [ENSMUST00000124515] [ENSMUST00000124603] [ENSMUST00000129489] [ENSMUST00000129993] [ENSMUST00000144645] [ENSMUST00000151529] [ENSMUST00000154899] [ENSMUST00000155530]
AlphaFold Q9CV28
Predicted Effect possibly damaging
Transcript: ENSMUST00000028105
AA Change: A137S

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028105
Gene: ENSMUSG00000026767
AA Change: A137S

DomainStartEndE-ValueType
DUF4205 9 351 1.48e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124515
AA Change: A90S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120193
Gene: ENSMUSG00000026767
AA Change: A90S

DomainStartEndE-ValueType
Blast:DUF4205 9 94 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000124603
SMART Domains Protein: ENSMUSP00000117457
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 79 8.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129348
AA Change: A43S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121265
Gene: ENSMUSG00000026767
AA Change: A43S

DomainStartEndE-ValueType
DUF4205 3 160 3.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129489
SMART Domains Protein: ENSMUSP00000122501
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 84 9.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129993
SMART Domains Protein: ENSMUSP00000141479
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 3 87 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144645
SMART Domains Protein: ENSMUSP00000116836
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
Pfam:DUF4205 11 87 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151529
Predicted Effect probably benign
Transcript: ENSMUST00000154899
SMART Domains Protein: ENSMUSP00000121476
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 1 110 6.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155530
SMART Domains Protein: ENSMUSP00000116939
Gene: ENSMUSG00000026767

DomainStartEndE-ValueType
DUF4205 9 135 6.24e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a caspase-associated recruitment domain and may function in apoptosis. It has been identified as a tumor suppressor in lung and gastric cancers, and a polymorphism in the gene may be associated with gastric cancer risk. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,628,181 (GRCm39) T294A probably damaging Het
Adamtsl2 G A 2: 26,997,473 (GRCm39) V893I probably damaging Het
Amph T A 13: 19,333,908 (GRCm39) D656E probably benign Het
Aoah T C 13: 21,207,485 (GRCm39) F568S probably damaging Het
Atr G A 9: 95,747,425 (GRCm39) G236S probably damaging Het
Brd3 T A 2: 27,340,406 (GRCm39) Q601L probably damaging Het
Ccar2 T C 14: 70,379,426 (GRCm39) E524G probably damaging Het
Cog2 T C 8: 125,267,853 (GRCm39) probably null Het
Csnka2ip C A 16: 64,299,120 (GRCm39) V415F unknown Het
Dmp1 A T 5: 104,359,729 (GRCm39) D135V probably damaging Het
Dtna T C 18: 23,786,436 (GRCm39) probably null Het
Endou A G 15: 97,616,810 (GRCm39) S238P probably damaging Het
Ep400 T A 5: 110,881,651 (GRCm39) E779D unknown Het
Fcgbp A G 7: 27,784,387 (GRCm39) E149G probably benign Het
G6pc1 C A 11: 101,265,413 (GRCm39) probably null Het
Gmeb1 T C 4: 131,962,179 (GRCm39) H160R probably damaging Het
Gramd1b T C 9: 40,312,902 (GRCm39) Y22C unknown Het
Hcrtr2 C T 9: 76,161,793 (GRCm39) G199D probably benign Het
Hoxb2 T C 11: 96,244,447 (GRCm39) F353L possibly damaging Het
Itpr2 C A 6: 146,226,572 (GRCm39) V1391F probably damaging Het
Jakmip2 T A 18: 43,673,648 (GRCm39) probably null Het
Kcnmb4 T C 10: 116,309,164 (GRCm39) Y88C possibly damaging Het
Kif1a T C 1: 93,005,507 (GRCm39) Y89C probably damaging Het
Kif23 T A 9: 61,827,174 (GRCm39) K892N probably damaging Het
Lama3 T A 18: 12,664,936 (GRCm39) S646T probably benign Het
Lig3 T A 11: 82,688,138 (GRCm39) M709K probably benign Het
Mis18bp1 T C 12: 65,196,057 (GRCm39) E569G possibly damaging Het
Misp T A 10: 79,662,999 (GRCm39) L472Q probably damaging Het
Mrps5 A T 2: 127,443,330 (GRCm39) T303S probably damaging Het
Msh3 T G 13: 92,411,308 (GRCm39) I630L probably benign Het
Muc21 C A 17: 35,932,432 (GRCm39) A585S unknown Het
Myo16 A G 8: 10,619,673 (GRCm39) Y1408C unknown Het
N4bp2 T C 5: 65,964,189 (GRCm39) V746A probably benign Het
Oga G A 19: 45,771,605 (GRCm39) probably benign Het
Or4c120 A G 2: 89,000,827 (GRCm39) I243T possibly damaging Het
Or4d11 A G 19: 12,013,752 (GRCm39) M118T probably damaging Het
Or5p56 A G 7: 107,589,805 (GRCm39) T78A possibly damaging Het
Ostf1 C T 19: 18,573,715 (GRCm39) M44I probably null Het
Pik3c2b T G 1: 133,033,712 (GRCm39) L1572R probably damaging Het
Pilra T C 5: 137,829,488 (GRCm39) D192G possibly damaging Het
Pkhd1l1 A G 15: 44,437,027 (GRCm39) I3462V probably benign Het
Plekhh1 A G 12: 79,113,429 (GRCm39) D619G probably benign Het
Pramel31 C T 4: 144,090,297 (GRCm39) R446C probably benign Het
Ptprb T A 10: 116,174,718 (GRCm39) Y797N probably damaging Het
Rb1 T C 14: 73,500,084 (GRCm39) D521G probably damaging Het
Rnf17 T G 14: 56,708,763 (GRCm39) F728V possibly damaging Het
Slc16a4 T C 3: 107,218,787 (GRCm39) S463P probably damaging Het
Slc4a1 A T 11: 102,244,693 (GRCm39) I634K probably damaging Het
Slc4a1ap T C 5: 31,701,201 (GRCm39) V634A probably benign Het
Spam1 A G 6: 24,800,583 (GRCm39) M441V probably benign Het
Teddm3 A C 16: 20,971,729 (GRCm39) L280* probably null Het
Tmem231 T C 8: 112,645,517 (GRCm39) probably null Het
Tom1l1 T C 11: 90,561,907 (GRCm39) probably null Het
Topors C T 4: 40,261,706 (GRCm39) G526D probably benign Het
Trpm6 A T 19: 18,790,911 (GRCm39) I649F possibly damaging Het
Ttc16 T A 2: 32,664,440 (GRCm39) M66L probably benign Het
Tubgcp6 A G 15: 88,985,232 (GRCm39) F1619L probably damaging Het
Vps13d G T 4: 144,842,062 (GRCm39) A2619E Het
Vps8 G A 16: 21,345,191 (GRCm39) R838H probably damaging Het
Vwde T A 6: 13,215,799 (GRCm39) M86L probably benign Het
Zfp64 A T 2: 168,768,357 (GRCm39) D418E probably benign Het
Zfp952 C T 17: 33,222,606 (GRCm39) P362S possibly damaging Het
Zglp1 T C 9: 20,977,368 (GRCm39) E149G probably benign Het
Other mutations in Mindy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Mindy3 APN 2 12,360,083 (GRCm39) splice site probably benign
IGL02623:Mindy3 APN 2 12,369,294 (GRCm39) nonsense probably null
R0944:Mindy3 UTSW 2 12,400,993 (GRCm39) missense possibly damaging 0.94
R1275:Mindy3 UTSW 2 12,400,984 (GRCm39) splice site probably null
R2066:Mindy3 UTSW 2 12,424,060 (GRCm39) missense probably damaging 1.00
R2232:Mindy3 UTSW 2 12,408,856 (GRCm39) missense probably benign 0.44
R2357:Mindy3 UTSW 2 12,408,987 (GRCm39) splice site probably benign
R3724:Mindy3 UTSW 2 12,360,165 (GRCm39) missense probably damaging 0.97
R4031:Mindy3 UTSW 2 12,405,894 (GRCm39) splice site probably null
R4089:Mindy3 UTSW 2 12,369,327 (GRCm39) missense probably benign 0.21
R4175:Mindy3 UTSW 2 12,410,676 (GRCm39) missense probably damaging 1.00
R4359:Mindy3 UTSW 2 12,401,020 (GRCm39) missense probably damaging 1.00
R4424:Mindy3 UTSW 2 12,353,010 (GRCm39) missense probably benign 0.00
R4640:Mindy3 UTSW 2 12,352,974 (GRCm39) missense probably benign 0.01
R4931:Mindy3 UTSW 2 12,401,024 (GRCm39) missense probably damaging 1.00
R5926:Mindy3 UTSW 2 12,352,911 (GRCm39) missense probably damaging 1.00
R5966:Mindy3 UTSW 2 12,405,854 (GRCm39) missense probably benign 0.17
R6330:Mindy3 UTSW 2 12,361,744 (GRCm39) missense probably damaging 1.00
R6518:Mindy3 UTSW 2 12,386,940 (GRCm39) missense probably damaging 1.00
R6587:Mindy3 UTSW 2 12,352,927 (GRCm39) nonsense probably null
R6852:Mindy3 UTSW 2 12,424,063 (GRCm39) start codon destroyed possibly damaging 0.53
R6961:Mindy3 UTSW 2 12,400,989 (GRCm39) critical splice donor site probably null
R7624:Mindy3 UTSW 2 12,424,000 (GRCm39) missense probably benign 0.00
R7661:Mindy3 UTSW 2 12,402,328 (GRCm39) missense probably damaging 1.00
R8474:Mindy3 UTSW 2 12,404,839 (GRCm39) missense probably damaging 1.00
R8518:Mindy3 UTSW 2 12,360,154 (GRCm39) missense probably damaging 1.00
R9541:Mindy3 UTSW 2 12,391,449 (GRCm39) missense probably damaging 1.00
R9578:Mindy3 UTSW 2 12,361,715 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGAAGCATATTTTGGCAGG -3'
(R):5'- AGTAACCCTTCTGTGTTCTCAG -3'

Sequencing Primer
(F):5'- GCATATTTTGGCAGGAAAATGATGC -3'
(R):5'- CCCTTCTGTGTTCTCAGTACTATATC -3'
Posted On 2019-05-15