Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Mrps5'

550975

Institutional Source

Beutler Lab

Gene Symbol

Mrps5

Ensembl Gene

ENSMUSG00000027374

Gene Name

mitochondrial ribosomal protein S5

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127587222-127606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 127601410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 303 (T303S)

Ref Sequence

ENSEMBL: ENSMUSP00000028852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028852]

AlphaFold

Q99N87

Predicted Effect

probably damaging
Transcript: ENSMUST00000028852
AA Change: T303S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: T303S

Domain	Start	End	E-Value	Type
low complexity region	108	126	N/A	INTRINSIC
Pfam:Ribosomal_S5	220	285	3.5e-20	PFAM
Pfam:Ribosomal_S5_C	297	368	4.7e-21	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Mrps5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01968:Mrps5	APN	2	127591907	missense	probably null	0.01
IGL03348:Mrps5	APN	2	127601385	missense	probably damaging	0.98
R0369:Mrps5	UTSW	2	127591829	missense	probably benign	0.09
R0485:Mrps5	UTSW	2	127591825	missense	possibly damaging	0.56
R0622:Mrps5	UTSW	2	127594531	missense	probably benign	0.00
R1954:Mrps5	UTSW	2	127596897	splice site	probably null
R2182:Mrps5	UTSW	2	127602487	missense	probably damaging	1.00
R3414:Mrps5	UTSW	2	127596912	missense	probably benign	0.38
R4007:Mrps5	UTSW	2	127591835	missense	possibly damaging	0.81
R4687:Mrps5	UTSW	2	127590770	missense	probably benign	0.44
R4780:Mrps5	UTSW	2	127598241	missense	probably benign	0.00
R4835:Mrps5	UTSW	2	127603707	missense	possibly damaging	0.84
R4851:Mrps5	UTSW	2	127590745	missense	probably benign	0.00
R5076:Mrps5	UTSW	2	127600852	nonsense	probably null
R5558:Mrps5	UTSW	2	127602435	missense	probably damaging	1.00
R6192:Mrps5	UTSW	2	127601385	missense	probably damaging	0.98
R7038:Mrps5	UTSW	2	127600866	missense	probably damaging	1.00
R7071:Mrps5	UTSW	2	127600852	nonsense	probably null
R7177:Mrps5	UTSW	2	127595697	missense	probably benign
R7319:Mrps5	UTSW	2	127595842	missense	possibly damaging	0.94
R7387:Mrps5	UTSW	2	127600884	missense	probably damaging	1.00
R7460:Mrps5	UTSW	2	127591891	missense	not run
R8211:Mrps5	UTSW	2	127603724	missense	probably benign
R9052:Mrps5	UTSW	2	127591956	splice site	probably benign
R9358:Mrps5	UTSW	2	127595814	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TGCAGACTGTGTCACAAGATG -3'
(R):5'- TTAGTGGTTATACTGCCAGCTC -3'

Sequencing Primer
(F):5'- CAGACTGTGTCACAAGATGTTTTTG -3'
(R):5'- GCCAGCTCCGTCAACTTGAC -3'

Posted On

2019-05-15