Incidental Mutation 'R7103:Zfp64'
ID 550976
Institutional Source Beutler Lab
Gene Symbol Zfp64
Ensembl Gene ENSMUSG00000027551
Gene Name zinc finger protein 64
Synonyms
MMRRC Submission 045195-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.828) question?
Stock # R7103 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 168735251-168797507 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 168768357 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 418 (D418E)
Ref Sequence ENSEMBL: ENSMUSP00000085285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087971] [ENSMUST00000109162]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087971
AA Change: D418E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085285
Gene: ENSMUSG00000027551
AA Change: D418E

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 308 6.32e-3 SMART
ZnF_C2H2 313 335 2.05e-2 SMART
ZnF_C2H2 341 363 1.95e-3 SMART
ZnF_C2H2 369 392 1.36e-2 SMART
ZnF_C2H2 423 445 1.47e-3 SMART
low complexity region 503 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109162
SMART Domains Protein: ENSMUSP00000104790
Gene: ENSMUSG00000027551

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 297 322 5.2e0 SMART
ZnF_C2H2 328 350 4.17e-3 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.24e-3 SMART
ZnF_C2H2 412 434 1.79e-2 SMART
ZnF_C2H2 440 463 9.58e-3 SMART
ZnF_C2H2 465 487 3.78e-1 SMART
ZnF_C2H2 493 515 3.89e-3 SMART
ZnF_C2H2 521 544 1.92e-2 SMART
ZnF_C2H2 578 600 5.34e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,628,181 (GRCm39) T294A probably damaging Het
Adamtsl2 G A 2: 26,997,473 (GRCm39) V893I probably damaging Het
Amph T A 13: 19,333,908 (GRCm39) D656E probably benign Het
Aoah T C 13: 21,207,485 (GRCm39) F568S probably damaging Het
Atr G A 9: 95,747,425 (GRCm39) G236S probably damaging Het
Brd3 T A 2: 27,340,406 (GRCm39) Q601L probably damaging Het
Ccar2 T C 14: 70,379,426 (GRCm39) E524G probably damaging Het
Cog2 T C 8: 125,267,853 (GRCm39) probably null Het
Csnka2ip C A 16: 64,299,120 (GRCm39) V415F unknown Het
Dmp1 A T 5: 104,359,729 (GRCm39) D135V probably damaging Het
Dtna T C 18: 23,786,436 (GRCm39) probably null Het
Endou A G 15: 97,616,810 (GRCm39) S238P probably damaging Het
Ep400 T A 5: 110,881,651 (GRCm39) E779D unknown Het
Fcgbp A G 7: 27,784,387 (GRCm39) E149G probably benign Het
G6pc1 C A 11: 101,265,413 (GRCm39) probably null Het
Gmeb1 T C 4: 131,962,179 (GRCm39) H160R probably damaging Het
Gramd1b T C 9: 40,312,902 (GRCm39) Y22C unknown Het
Hcrtr2 C T 9: 76,161,793 (GRCm39) G199D probably benign Het
Hoxb2 T C 11: 96,244,447 (GRCm39) F353L possibly damaging Het
Itpr2 C A 6: 146,226,572 (GRCm39) V1391F probably damaging Het
Jakmip2 T A 18: 43,673,648 (GRCm39) probably null Het
Kcnmb4 T C 10: 116,309,164 (GRCm39) Y88C possibly damaging Het
Kif1a T C 1: 93,005,507 (GRCm39) Y89C probably damaging Het
Kif23 T A 9: 61,827,174 (GRCm39) K892N probably damaging Het
Lama3 T A 18: 12,664,936 (GRCm39) S646T probably benign Het
Lig3 T A 11: 82,688,138 (GRCm39) M709K probably benign Het
Mindy3 C A 2: 12,405,885 (GRCm39) A137S possibly damaging Het
Mis18bp1 T C 12: 65,196,057 (GRCm39) E569G possibly damaging Het
Misp T A 10: 79,662,999 (GRCm39) L472Q probably damaging Het
Mrps5 A T 2: 127,443,330 (GRCm39) T303S probably damaging Het
Msh3 T G 13: 92,411,308 (GRCm39) I630L probably benign Het
Muc21 C A 17: 35,932,432 (GRCm39) A585S unknown Het
Myo16 A G 8: 10,619,673 (GRCm39) Y1408C unknown Het
N4bp2 T C 5: 65,964,189 (GRCm39) V746A probably benign Het
Oga G A 19: 45,771,605 (GRCm39) probably benign Het
Or4c120 A G 2: 89,000,827 (GRCm39) I243T possibly damaging Het
Or4d11 A G 19: 12,013,752 (GRCm39) M118T probably damaging Het
Or5p56 A G 7: 107,589,805 (GRCm39) T78A possibly damaging Het
Ostf1 C T 19: 18,573,715 (GRCm39) M44I probably null Het
Pik3c2b T G 1: 133,033,712 (GRCm39) L1572R probably damaging Het
Pilra T C 5: 137,829,488 (GRCm39) D192G possibly damaging Het
Pkhd1l1 A G 15: 44,437,027 (GRCm39) I3462V probably benign Het
Plekhh1 A G 12: 79,113,429 (GRCm39) D619G probably benign Het
Pramel31 C T 4: 144,090,297 (GRCm39) R446C probably benign Het
Ptprb T A 10: 116,174,718 (GRCm39) Y797N probably damaging Het
Rb1 T C 14: 73,500,084 (GRCm39) D521G probably damaging Het
Rnf17 T G 14: 56,708,763 (GRCm39) F728V possibly damaging Het
Slc16a4 T C 3: 107,218,787 (GRCm39) S463P probably damaging Het
Slc4a1 A T 11: 102,244,693 (GRCm39) I634K probably damaging Het
Slc4a1ap T C 5: 31,701,201 (GRCm39) V634A probably benign Het
Spam1 A G 6: 24,800,583 (GRCm39) M441V probably benign Het
Teddm3 A C 16: 20,971,729 (GRCm39) L280* probably null Het
Tmem231 T C 8: 112,645,517 (GRCm39) probably null Het
Tom1l1 T C 11: 90,561,907 (GRCm39) probably null Het
Topors C T 4: 40,261,706 (GRCm39) G526D probably benign Het
Trpm6 A T 19: 18,790,911 (GRCm39) I649F possibly damaging Het
Ttc16 T A 2: 32,664,440 (GRCm39) M66L probably benign Het
Tubgcp6 A G 15: 88,985,232 (GRCm39) F1619L probably damaging Het
Vps13d G T 4: 144,842,062 (GRCm39) A2619E Het
Vps8 G A 16: 21,345,191 (GRCm39) R838H probably damaging Het
Vwde T A 6: 13,215,799 (GRCm39) M86L probably benign Het
Zfp952 C T 17: 33,222,606 (GRCm39) P362S possibly damaging Het
Zglp1 T C 9: 20,977,368 (GRCm39) E149G probably benign Het
Other mutations in Zfp64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Zfp64 APN 2 168,768,601 (GRCm39) missense probably benign 0.06
IGL01479:Zfp64 APN 2 168,793,599 (GRCm39) missense probably damaging 1.00
IGL02320:Zfp64 APN 2 168,768,118 (GRCm39) missense probably damaging 0.98
IGL03411:Zfp64 APN 2 168,793,462 (GRCm39) splice site probably null
PIT4362001:Zfp64 UTSW 2 168,767,735 (GRCm39) missense probably benign 0.23
R0033:Zfp64 UTSW 2 168,767,635 (GRCm39) missense possibly damaging 0.94
R0033:Zfp64 UTSW 2 168,767,635 (GRCm39) missense possibly damaging 0.94
R0230:Zfp64 UTSW 2 168,754,150 (GRCm39) splice site probably benign
R0325:Zfp64 UTSW 2 168,767,960 (GRCm39) missense probably benign 0.00
R0689:Zfp64 UTSW 2 168,777,121 (GRCm39) splice site probably benign
R1741:Zfp64 UTSW 2 168,768,238 (GRCm39) missense probably benign 0.05
R2054:Zfp64 UTSW 2 168,767,728 (GRCm39) missense probably damaging 1.00
R2133:Zfp64 UTSW 2 168,782,663 (GRCm39) missense probably damaging 1.00
R2254:Zfp64 UTSW 2 168,768,662 (GRCm39) missense probably damaging 0.96
R4093:Zfp64 UTSW 2 168,767,855 (GRCm39) missense probably benign 0.00
R4094:Zfp64 UTSW 2 168,767,855 (GRCm39) missense probably benign 0.00
R4257:Zfp64 UTSW 2 168,768,298 (GRCm39) missense probably damaging 1.00
R4630:Zfp64 UTSW 2 168,768,463 (GRCm39) missense possibly damaging 0.94
R4642:Zfp64 UTSW 2 168,776,851 (GRCm39) missense probably benign 0.22
R4817:Zfp64 UTSW 2 168,768,032 (GRCm39) missense probably benign
R4880:Zfp64 UTSW 2 168,736,297 (GRCm39) missense probably damaging 1.00
R5051:Zfp64 UTSW 2 168,768,304 (GRCm39) missense probably damaging 0.98
R5155:Zfp64 UTSW 2 168,748,885 (GRCm39) missense probably benign 0.17
R5562:Zfp64 UTSW 2 168,767,642 (GRCm39) missense probably benign 0.00
R5619:Zfp64 UTSW 2 168,741,735 (GRCm39) missense probably damaging 0.97
R5619:Zfp64 UTSW 2 168,741,734 (GRCm39) missense probably damaging 0.99
R5620:Zfp64 UTSW 2 168,741,888 (GRCm39) missense possibly damaging 0.70
R5919:Zfp64 UTSW 2 168,768,419 (GRCm39) missense probably benign 0.05
R6156:Zfp64 UTSW 2 168,768,088 (GRCm39) missense probably benign 0.34
R6364:Zfp64 UTSW 2 168,754,186 (GRCm39) missense probably damaging 1.00
R6488:Zfp64 UTSW 2 168,777,129 (GRCm39) critical splice donor site probably null
R6512:Zfp64 UTSW 2 168,735,997 (GRCm39) missense probably benign 0.00
R6588:Zfp64 UTSW 2 168,768,827 (GRCm39) missense probably damaging 1.00
R7313:Zfp64 UTSW 2 168,741,810 (GRCm39) missense probably damaging 1.00
R7470:Zfp64 UTSW 2 168,767,731 (GRCm39) missense probably damaging 1.00
R7529:Zfp64 UTSW 2 168,735,992 (GRCm39) missense probably benign
R7560:Zfp64 UTSW 2 168,767,585 (GRCm39) missense probably damaging 1.00
R7963:Zfp64 UTSW 2 168,793,538 (GRCm39) missense probably benign 0.32
R8037:Zfp64 UTSW 2 168,741,932 (GRCm39) missense probably damaging 1.00
R8038:Zfp64 UTSW 2 168,741,932 (GRCm39) missense probably damaging 1.00
R8825:Zfp64 UTSW 2 168,793,552 (GRCm39) missense probably benign
R8840:Zfp64 UTSW 2 168,768,635 (GRCm39) missense probably benign
R8891:Zfp64 UTSW 2 168,797,083 (GRCm39) start codon destroyed probably null 0.37
R9062:Zfp64 UTSW 2 168,767,747 (GRCm39) missense probably benign
R9592:Zfp64 UTSW 2 168,768,118 (GRCm39) missense probably damaging 1.00
R9681:Zfp64 UTSW 2 168,793,680 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGGATTTGCTCTACGG -3'
(R):5'- AGTGCAGCTACTCCTGTTCC -3'

Sequencing Primer
(F):5'- CCTGGATTTGCTCTACGGTGAGG -3'
(R):5'- AGCTACTCCTGTTCCAGCAAGG -3'
Posted On 2019-05-15