Incidental Mutation 'R7103:Zfp64'
List |< first << previous [record 62 of 64] next >> last >|
ID550976
Institutional Source Beutler Lab
Gene Symbol Zfp64
Ensembl Gene ENSMUSG00000027551
Gene Namezinc finger protein 64
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location168893331-168955587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 168926437 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 418 (D418E)
Ref Sequence ENSEMBL: ENSMUSP00000085285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087971] [ENSMUST00000109162]
Predicted Effect probably benign
Transcript: ENSMUST00000087971
AA Change: D418E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000085285
Gene: ENSMUSG00000027551
AA Change: D418E

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 308 6.32e-3 SMART
ZnF_C2H2 313 335 2.05e-2 SMART
ZnF_C2H2 341 363 1.95e-3 SMART
ZnF_C2H2 369 392 1.36e-2 SMART
ZnF_C2H2 423 445 1.47e-3 SMART
low complexity region 503 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109162
SMART Domains Protein: ENSMUSP00000104790
Gene: ENSMUSG00000027551

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 297 322 5.2e0 SMART
ZnF_C2H2 328 350 4.17e-3 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.24e-3 SMART
ZnF_C2H2 412 434 1.79e-2 SMART
ZnF_C2H2 440 463 9.58e-3 SMART
ZnF_C2H2 465 487 3.78e-1 SMART
ZnF_C2H2 493 515 3.89e-3 SMART
ZnF_C2H2 521 544 1.92e-2 SMART
ZnF_C2H2 578 600 5.34e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Zfp64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Zfp64 APN 2 168926681 missense probably benign 0.06
IGL01479:Zfp64 APN 2 168951679 missense probably damaging 1.00
IGL02320:Zfp64 APN 2 168926198 missense probably damaging 0.98
IGL03411:Zfp64 APN 2 168951542 splice site probably null
PIT4362001:Zfp64 UTSW 2 168925815 missense probably benign 0.23
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0230:Zfp64 UTSW 2 168912230 splice site probably benign
R0325:Zfp64 UTSW 2 168926040 missense probably benign 0.00
R0689:Zfp64 UTSW 2 168935201 splice site probably benign
R1741:Zfp64 UTSW 2 168926318 missense probably benign 0.05
R2054:Zfp64 UTSW 2 168925808 missense probably damaging 1.00
R2133:Zfp64 UTSW 2 168940743 missense probably damaging 1.00
R2254:Zfp64 UTSW 2 168926742 missense probably damaging 0.96
R4093:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4094:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4257:Zfp64 UTSW 2 168926378 missense probably damaging 1.00
R4630:Zfp64 UTSW 2 168926543 missense possibly damaging 0.94
R4642:Zfp64 UTSW 2 168934931 missense probably benign 0.22
R4817:Zfp64 UTSW 2 168926112 missense probably benign
R4880:Zfp64 UTSW 2 168894377 missense probably damaging 1.00
R5051:Zfp64 UTSW 2 168926384 missense probably damaging 0.98
R5155:Zfp64 UTSW 2 168906965 missense probably benign 0.17
R5562:Zfp64 UTSW 2 168925722 missense probably benign 0.00
R5619:Zfp64 UTSW 2 168899814 missense probably damaging 0.99
R5619:Zfp64 UTSW 2 168899815 missense probably damaging 0.97
R5620:Zfp64 UTSW 2 168899968 missense possibly damaging 0.70
R5919:Zfp64 UTSW 2 168926499 missense probably benign 0.05
R6156:Zfp64 UTSW 2 168926168 missense probably benign 0.34
R6364:Zfp64 UTSW 2 168912266 missense probably damaging 1.00
R6488:Zfp64 UTSW 2 168935209 critical splice donor site probably null
R6512:Zfp64 UTSW 2 168894077 missense probably benign 0.00
R6588:Zfp64 UTSW 2 168926907 missense probably damaging 1.00
R7313:Zfp64 UTSW 2 168899890 missense probably damaging 1.00
R7470:Zfp64 UTSW 2 168925811 missense probably damaging 1.00
R7529:Zfp64 UTSW 2 168894072 missense probably benign
R7560:Zfp64 UTSW 2 168925665 missense probably damaging 1.00
R7963:Zfp64 UTSW 2 168951618 missense probably benign 0.32
R8037:Zfp64 UTSW 2 168900012 missense probably damaging 1.00
R8038:Zfp64 UTSW 2 168900012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGGATTTGCTCTACGG -3'
(R):5'- AGTGCAGCTACTCCTGTTCC -3'

Sequencing Primer
(F):5'- CCTGGATTTGCTCTACGGTGAGG -3'
(R):5'- AGCTACTCCTGTTCCAGCAAGG -3'
Posted On2019-05-15