Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Topors'

550978

Institutional Source

Beutler Lab

Gene Symbol

Topors

Ensembl Gene

ENSMUSG00000036822

Gene Name

topoisomerase I binding, arginine/serine-rich

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.551) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40259601-40269850 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 40261706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 526 (G526D)

Ref Sequence

ENSEMBL: ENSMUSP00000046843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042575]

AlphaFold

Q80Z37

Predicted Effect

probably benign
Transcript: ENSMUST00000042575
AA Change: G526D

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822
AA Change: G526D

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	29	44	N/A	INTRINSIC
RING	104	142	7.27e-7	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	381	391	N/A	INTRINSIC
low complexity region	434	454	N/A	INTRINSIC
low complexity region	465	478	N/A	INTRINSIC
low complexity region	494	505	N/A	INTRINSIC
low complexity region	522	535	N/A	INTRINSIC
low complexity region	589	610	N/A	INTRINSIC
low complexity region	620	696	N/A	INTRINSIC
low complexity region	756	780	N/A	INTRINSIC
low complexity region	837	860	N/A	INTRINSIC
low complexity region	877	894	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is serine and arginine rich, and contains a RING-type zinc finger domain. It is highly expressed in the testis, and functions as an ubiquitin-protein E3 ligase. Mutations in this gene are associated with retinitis pigmentosa type 31. Alternatively spliced transcript variants, encoding different isoforms, have been observed for this locus. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Topors

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Topors	APN	4	40262417	missense	probably damaging	1.00
IGL01541:Topors	APN	4	40262364	missense	possibly damaging	0.70
IGL02093:Topors	APN	4	40261467	missense	probably damaging	0.98
R0039:Topors	UTSW	4	40262772	missense	probably damaging	1.00
R0483:Topors	UTSW	4	40261952	missense	probably damaging	0.96
R0645:Topors	UTSW	4	40260333	missense	unknown
R1413:Topors	UTSW	4	40261982	missense	probably benign	0.01
R1507:Topors	UTSW	4	40261829	missense	probably damaging	0.99
R1677:Topors	UTSW	4	40261776	missense	probably damaging	0.99
R1863:Topors	UTSW	4	40262149	nonsense	probably null
R1960:Topors	UTSW	4	40261044	missense	unknown
R2035:Topors	UTSW	4	40262879	missense	probably damaging	1.00
R2155:Topors	UTSW	4	40262790	missense	possibly damaging	0.72
R2519:Topors	UTSW	4	40261714	nonsense	probably null
R3035:Topors	UTSW	4	40269673	critical splice donor site	probably null
R3037:Topors	UTSW	4	40269673	critical splice donor site	probably null
R3842:Topors	UTSW	4	40262123	missense	probably benign	0.01
R4090:Topors	UTSW	4	40260794	missense	unknown
R4668:Topors	UTSW	4	40262669	missense	probably damaging	0.98
R4686:Topors	UTSW	4	40261694	missense	probably benign	0.03
R4694:Topors	UTSW	4	40261442	missense	possibly damaging	0.94
R4749:Topors	UTSW	4	40261015	missense	unknown
R5228:Topors	UTSW	4	40262367	missense	probably damaging	1.00
R5304:Topors	UTSW	4	40262541	missense	possibly damaging	0.50
R5725:Topors	UTSW	4	40261952	missense	probably damaging	0.96
R6617:Topors	UTSW	4	40261896	nonsense	probably null
R6699:Topors	UTSW	4	40262300	missense	probably damaging	0.97
R6869:Topors	UTSW	4	40261201	missense	unknown
R7319:Topors	UTSW	4	40260540	missense	unknown
R7543:Topors	UTSW	4	40268312	missense	probably damaging	0.99
R7545:Topors	UTSW	4	40262173	missense	possibly damaging	0.91
R7559:Topors	UTSW	4	40261401	missense	unknown
R7748:Topors	UTSW	4	40262654	missense	probably damaging	1.00
R7899:Topors	UTSW	4	40260356	missense	unknown
R8045:Topors	UTSW	4	40261988	missense	probably benign	0.17
R8056:Topors	UTSW	4	40262221	missense	probably benign	0.30
R8221:Topors	UTSW	4	40260686	missense	unknown
R8846:Topors	UTSW	4	40262952	missense	probably damaging	0.98
R9001:Topors	UTSW	4	40261696	missense	possibly damaging	0.65
R9582:Topors	UTSW	4	40260460	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCCTGTCACCTCTTGTAGATGAG -3'
(R):5'- CTTGTCTCTGGAGGAACCACATC -3'

Sequencing Primer
(F):5'- GTCACCTCTTGTAGATGAGCTGTC -3'
(R):5'- AGTACAGACCAATGACGATGTC -3'

Posted On

2019-05-15