Incidental Mutation 'R7103:Gmeb1'
ID550979
Institutional Source Beutler Lab
Gene Symbol Gmeb1
Ensembl Gene ENSMUSG00000028901
Gene Nameglucocorticoid modulatory element binding protein 1
Synonyms1110050A04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132221025-132261602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132234868 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 160 (H160R)
Ref Sequence ENSEMBL: ENSMUSP00000030733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030733] [ENSMUST00000105964] [ENSMUST00000105965] [ENSMUST00000168553]
Predicted Effect probably damaging
Transcript: ENSMUST00000030733
AA Change: H160R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030733
Gene: ENSMUSG00000028901
AA Change: H160R

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105964
AA Change: H160R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101584
Gene: ENSMUSG00000028901
AA Change: H160R

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105965
AA Change: H160R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101585
Gene: ENSMUSG00000028901
AA Change: H160R

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168553
AA Change: H160R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131331
Gene: ENSMUSG00000028901
AA Change: H160R

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
SAND 83 156 8.01e-36 SMART
low complexity region 232 244 N/A INTRINSIC
coiled coil region 311 345 N/A INTRINSIC
low complexity region 364 371 N/A INTRINSIC
low complexity region 457 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Three alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Gmeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Gmeb1 APN 4 132227985 missense probably benign 0.00
IGL02089:Gmeb1 APN 4 132225836 missense probably damaging 1.00
R0137:Gmeb1 UTSW 4 132232108 missense probably benign 0.01
R0326:Gmeb1 UTSW 4 132242352 missense probably damaging 0.98
R0611:Gmeb1 UTSW 4 132226075 nonsense probably null
R0898:Gmeb1 UTSW 4 132234782 missense probably benign 0.01
R1317:Gmeb1 UTSW 4 132234887 nonsense probably null
R1453:Gmeb1 UTSW 4 132242448 missense possibly damaging 0.56
R1573:Gmeb1 UTSW 4 132251740 missense probably benign 0.12
R1751:Gmeb1 UTSW 4 132234887 nonsense probably null
R1754:Gmeb1 UTSW 4 132232027 missense probably benign
R1761:Gmeb1 UTSW 4 132234887 nonsense probably null
R5203:Gmeb1 UTSW 4 132232009 splice site probably null
R6241:Gmeb1 UTSW 4 132242377 missense possibly damaging 0.64
R6241:Gmeb1 UTSW 4 132246013 missense probably benign 0.00
R7192:Gmeb1 UTSW 4 132227890 missense probably benign 0.03
R7401:Gmeb1 UTSW 4 132225774 missense probably damaging 0.97
R7528:Gmeb1 UTSW 4 132232050 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GTGACGCTGTACAAAGTAAGGC -3'
(R):5'- CCACAGTCTCAGAAGAGTAGTGG -3'

Sequencing Primer
(F):5'- CGCTGTACAAAGTAAGGCTGGTG -3'
(R):5'- ACCAACGGGCGTTTGTAATTC -3'
Posted On2019-05-15