Incidental Mutation 'R7103:Slc4a1ap'
List |< first << previous [record 50 of 64] next >> last >|
ID550982
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Namesolute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonymskanadaptin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.693) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31526995-31556932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31543857 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 634 (V634A)
Ref Sequence ENSEMBL: ENSMUSP00000110179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114533] [ENSMUST00000202214] [ENSMUST00000202950]
Predicted Effect probably benign
Transcript: ENSMUST00000114533
AA Change: V634A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141
AA Change: V634A

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201789
Predicted Effect probably benign
Transcript: ENSMUST00000201925
Predicted Effect probably benign
Transcript: ENSMUST00000202214
AA Change: V634A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141
AA Change: V634A

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202273
AA Change: V25A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000202950
AA Change: V634A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141
AA Change: V634A

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31553777 missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31528227 missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31534210 splice site probably null
R1694:Slc4a1ap UTSW 5 31543754 missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31534180 missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31528139 missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31532029 missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31530709 nonsense probably null
R5611:Slc4a1ap UTSW 5 31553829 utr 3 prime probably benign
R5648:Slc4a1ap UTSW 5 31550785 splice site probably null
R5991:Slc4a1ap UTSW 5 31534069 missense possibly damaging 0.92
R6531:Slc4a1ap UTSW 5 31548638 missense probably benign 0.18
R6602:Slc4a1ap UTSW 5 31527641 missense probably damaging 1.00
R6770:Slc4a1ap UTSW 5 31527882 splice site probably null
R6844:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R7342:Slc4a1ap UTSW 5 31536290 missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31527527 missense probably benign
R7527:Slc4a1ap UTSW 5 31534131 missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31546195 missense
R7608:Slc4a1ap UTSW 5 31536189 missense possibly damaging 0.51
R7781:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGAAGTTGCCACCCAAGC -3'
(R):5'- CAACAAACACAACTGGTTTTGC -3'

Sequencing Primer
(F):5'- GCGTCCAGAACTCCCTCCAG -3'
(R):5'- CCAAGACAGGGTTTCTCTGTATAGC -3'
Posted On2019-05-15