Incidental Mutation 'R7103:Itpr2'
ID550989
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 146325074 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1391 (V1391F)
Ref Sequence ENSEMBL: ENSMUSP00000049584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
Predicted Effect probably damaging
Transcript: ENSMUST00000053273
AA Change: V1391F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: V1391F

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079573
AA Change: V1358F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: V1358F

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
dollar_short UTSW 6 146397019 nonsense probably null
enfermos UTSW 6 146234006 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 synonymous probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146327187 missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146359340 missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146373208 missense probably benign 0.06
R7448:Itpr2 UTSW 6 146329508 missense probably damaging 1.00
R7492:Itpr2 UTSW 6 146390938 missense probably damaging 1.00
R7515:Itpr2 UTSW 6 146327110 missense probably damaging 1.00
R7529:Itpr2 UTSW 6 146194598 missense probably damaging 0.98
R7558:Itpr2 UTSW 6 146390865 missense probably damaging 1.00
R7650:Itpr2 UTSW 6 146233994 missense probably benign 0.36
R7678:Itpr2 UTSW 6 146187550 missense probably benign 0.00
R7790:Itpr2 UTSW 6 146224776 missense probably damaging 1.00
R7798:Itpr2 UTSW 6 146386015 missense probably benign 0.06
R7831:Itpr2 UTSW 6 146291584 missense probably benign 0.04
R8023:Itpr2 UTSW 6 146187490 missense probably damaging 0.97
R8046:Itpr2 UTSW 6 146426459 missense probably damaging 0.96
R8236:Itpr2 UTSW 6 146390783 critical splice donor site probably null
R8241:Itpr2 UTSW 6 146418515 missense possibly damaging 0.90
R8245:Itpr2 UTSW 6 146373106 missense probably damaging 0.98
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGACTAAGTACAGTTAAGTCC -3'
(R):5'- TCTTCCTTTCAGTTGATCAATGGG -3'

Sequencing Primer
(F):5'- AGTCCTCTACTAAATAGTCGATGTC -3'
(R):5'- TCAGTTGATCAATGGGGGCGAG -3'
Posted On2019-05-15