Incidental Mutation 'R0597:Sycp2'
ID55099
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 038786-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0597 (G1)
Quality Score220
Status Validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 178356580 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1049 (V1049G)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081134
AA Change: V1049G

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: V1049G

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132611
Meta Mutation Damage Score 0.1685 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 94.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T C 1: 165,525,062 probably null Het
Anxa11 T C 14: 25,874,228 I221T probably damaging Het
Arhgap33 C G 7: 30,526,446 R565P probably damaging Het
Bmpr2 T C 1: 59,841,425 probably benign Het
Btn2a2 T A 13: 23,486,410 H51L probably benign Het
Casz1 T C 4: 148,944,394 S1099P probably benign Het
Cnot4 A G 6: 35,051,503 S393P possibly damaging Het
Cntnap5a T C 1: 116,184,461 probably benign Het
Cobl T C 11: 12,254,699 T586A probably benign Het
Crocc A G 4: 141,017,071 L1838P probably benign Het
Crocc T C 4: 141,019,913 K1528R probably benign Het
Dact2 A G 17: 14,197,041 V299A probably benign Het
Dapk1 C A 13: 60,761,384 N1270K probably benign Het
Ddx41 T C 13: 55,533,006 Y375C probably damaging Het
Dock5 T A 14: 67,784,934 probably null Het
Dyrk4 T G 6: 126,886,649 probably null Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Fam210b A G 2: 172,345,853 probably benign Het
Fbxl13 A G 5: 21,614,714 I229T probably benign Het
Fbxo39 A G 11: 72,316,921 D33G probably damaging Het
Fbxw11 A G 11: 32,720,496 E120G probably damaging Het
Fbxw2 A T 2: 34,811,020 L261Q probably damaging Het
Gm13084 G T 4: 143,812,652 N90K probably damaging Het
Gm5800 A C 14: 51,716,004 N51K probably benign Het
Gm6899 A G 11: 26,593,768 probably benign Het
Gm9745 C A 13: 8,940,766 probably benign Het
Gpx8 T C 13: 113,045,501 T133A possibly damaging Het
Grin3a C T 4: 49,665,351 V1095M probably damaging Het
Grip2 T C 6: 91,796,197 probably benign Het
Hacd4 A G 4: 88,437,520 F43L probably damaging Het
Hif1a T G 12: 73,942,275 S645R probably benign Het
Hipk3 A G 2: 104,433,637 S839P possibly damaging Het
Il16 A T 7: 83,677,975 probably benign Het
Il3ra T A 14: 14,351,166 probably null Het
Il5ra A G 6: 106,744,335 M1T probably null Het
Klra2 G A 6: 131,220,185 R251C probably benign Het
Lamc2 C T 1: 153,133,621 V813M probably benign Het
Lbr A G 1: 181,832,213 V139A probably benign Het
Lrp5 T C 19: 3,600,777 D1219G possibly damaging Het
Map3k6 C T 4: 133,245,552 P341S possibly damaging Het
Mcts2 A G 2: 152,687,689 E140G probably benign Het
Med1 T C 11: 98,169,438 M222V probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Muc19 A T 15: 91,900,502 noncoding transcript Het
Nr1h2 A G 7: 44,552,260 probably benign Het
Olfr1361 C A 13: 21,659,146 R59L probably damaging Het
Olfr205 A T 16: 59,328,760 F250I probably damaging Het
Olfr682-ps1 A G 7: 105,128,218 V73A possibly damaging Het
Olfr71 A T 4: 43,706,592 probably null Het
P4hb G A 11: 120,568,244 T141I possibly damaging Het
Polr3a A G 14: 24,484,134 V101A probably benign Het
Pou4f2 A G 8: 78,435,240 S245P probably benign Het
Rnpep A G 1: 135,272,419 V266A probably damaging Het
Scly G A 1: 91,309,833 G206R probably damaging Het
Sec14l3 A T 11: 4,074,814 K254N probably damaging Het
Sgpp1 A T 12: 75,735,100 I155N probably damaging Het
Slc22a14 A G 9: 119,172,124 L468P probably damaging Het
Slc22a27 A G 19: 7,865,884 F377L probably benign Het
Slc44a3 T C 3: 121,460,070 I625V probably benign Het
Slc47a2 A T 11: 61,309,976 I373N probably damaging Het
Slfn10-ps A T 11: 83,035,653 noncoding transcript Het
Smarcd1 T A 15: 99,711,094 I383N probably damaging Het
Sort1 A G 3: 108,338,910 D401G probably damaging Het
Sprr2a3 G T 3: 92,288,590 M1I probably null Het
Tecrl T A 5: 83,354,928 K10* probably null Het
Tnpo3 A T 6: 29,578,565 C303* probably null Het
Vmn2r23 A G 6: 123,729,721 I503M probably benign Het
Zbtb8os T A 4: 129,346,877 I164N probably damaging Het
Zfp292 T C 4: 34,807,399 N1882D probably benign Het
Zfp91 T C 19: 12,770,095 I555V possibly damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
R7805:Sycp2 UTSW 2 178380858 missense probably damaging 0.99
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTTCTGAAGTTGGCAAAGCAACAACA -3'
(R):5'- AGCAAAGACCCGAGTTTCTCAAGTG -3'

Sequencing Primer
(F):5'- CCAAAGTAATTGGCACTAACTGG -3'
(R):5'- GGCACACAAACTTTAGTGTCTC -3'
Posted On2013-07-11