Incidental Mutation 'R7103:Olfr477'
List |< first << previous [record 39 of 64] next >> last >|
ID550991
Institutional Source Beutler Lab
Gene Symbol Olfr477
Ensembl Gene ENSMUSG00000096151
Gene Nameolfactory receptor 477
SynonymsGA_x6K02T2PBJ9-10319672-10320604, MOR204-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107986693-107992723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107990598 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 78 (T78A)
Ref Sequence ENSEMBL: ENSMUSP00000150605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091605] [ENSMUST00000214677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091605
AA Change: T78A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091654
Gene: ENSMUSG00000096151
AA Change: T78A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 290 1.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214677
AA Change: T78A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Olfr477
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Olfr477 APN 7 107990890 missense probably damaging 0.97
IGL01078:Olfr477 APN 7 107990943 missense probably benign 0.02
IGL01141:Olfr477 APN 7 107990551 missense probably damaging 1.00
IGL02613:Olfr477 APN 7 107991174 nonsense probably null
R0625:Olfr477 UTSW 7 107991189 missense probably damaging 1.00
R0791:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R1254:Olfr477 UTSW 7 107990440 missense probably benign 0.01
R1456:Olfr477 UTSW 7 107990398 missense probably benign 0.06
R1522:Olfr477 UTSW 7 107990533 missense probably benign 0.27
R1541:Olfr477 UTSW 7 107990841 missense probably benign 0.10
R2889:Olfr477 UTSW 7 107990577 missense probably benign 0.06
R5653:Olfr477 UTSW 7 107990385 missense probably benign 0.38
R6146:Olfr477 UTSW 7 107990413 missense probably damaging 1.00
R6190:Olfr477 UTSW 7 107991100 missense probably damaging 1.00
R7191:Olfr477 UTSW 7 107990646 missense possibly damaging 0.88
R7553:Olfr477 UTSW 7 107990475 missense probably benign 0.03
R7681:Olfr477 UTSW 7 107991148 missense possibly damaging 0.80
Z1088:Olfr477 UTSW 7 107990731 missense probably benign 0.42
Z1177:Olfr477 UTSW 7 107991094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCCACACTACGTGTCATCC -3'
(R):5'- TGTCCCTGAATTCACACAGC -3'

Sequencing Primer
(F):5'- CACACTACGTGTCATCCTATTTATG -3'
(R):5'- CAGATCCTGGGAGACATATGTG -3'
Posted On2019-05-15