Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Cog2'

550993

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 124541114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably null
Transcript: ENSMUST00000034460

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AAAATCCCACCGTTTGTTCTTG -3'
(R):5'- CACATATGTGCTGTGGACGTG -3'

Sequencing Primer
(F):5'- GTTCTAGAAATACACTGTGAGCATGG -3'
(R):5'- GGGAGTAAAGATACCTAAGCCTCC -3'

Posted On

2019-05-15