Incidental Mutation 'R7103:Kif23'
ID 550996
Institutional Source Beutler Lab
Gene Symbol Kif23
Ensembl Gene ENSMUSG00000032254
Gene Name kinesin family member 23
Synonyms Knsl5, CHO1, C87313, MKLP-1, 3110001D19Rik, MKLP1
MMRRC Submission 045195-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.972) question?
Stock # R7103 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 61824559-61854078 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61827174 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 892 (K892N)
Ref Sequence ENSEMBL: ENSMUSP00000034815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034815]
AlphaFold E9Q5G3
Predicted Effect probably damaging
Transcript: ENSMUST00000034815
AA Change: K892N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: K892N

DomainStartEndE-ValueType
KISc 23 444 6.56e-147 SMART
Blast:KISc 524 607 8e-20 BLAST
low complexity region 661 678 N/A INTRINSIC
low complexity region 681 693 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
Pfam:MKLP1_Arf_bdg 796 899 9.2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,628,181 (GRCm39) T294A probably damaging Het
Adamtsl2 G A 2: 26,997,473 (GRCm39) V893I probably damaging Het
Amph T A 13: 19,333,908 (GRCm39) D656E probably benign Het
Aoah T C 13: 21,207,485 (GRCm39) F568S probably damaging Het
Atr G A 9: 95,747,425 (GRCm39) G236S probably damaging Het
Brd3 T A 2: 27,340,406 (GRCm39) Q601L probably damaging Het
Ccar2 T C 14: 70,379,426 (GRCm39) E524G probably damaging Het
Cog2 T C 8: 125,267,853 (GRCm39) probably null Het
Csnka2ip C A 16: 64,299,120 (GRCm39) V415F unknown Het
Dmp1 A T 5: 104,359,729 (GRCm39) D135V probably damaging Het
Dtna T C 18: 23,786,436 (GRCm39) probably null Het
Endou A G 15: 97,616,810 (GRCm39) S238P probably damaging Het
Ep400 T A 5: 110,881,651 (GRCm39) E779D unknown Het
Fcgbp A G 7: 27,784,387 (GRCm39) E149G probably benign Het
G6pc1 C A 11: 101,265,413 (GRCm39) probably null Het
Gmeb1 T C 4: 131,962,179 (GRCm39) H160R probably damaging Het
Gramd1b T C 9: 40,312,902 (GRCm39) Y22C unknown Het
Hcrtr2 C T 9: 76,161,793 (GRCm39) G199D probably benign Het
Hoxb2 T C 11: 96,244,447 (GRCm39) F353L possibly damaging Het
Itpr2 C A 6: 146,226,572 (GRCm39) V1391F probably damaging Het
Jakmip2 T A 18: 43,673,648 (GRCm39) probably null Het
Kcnmb4 T C 10: 116,309,164 (GRCm39) Y88C possibly damaging Het
Kif1a T C 1: 93,005,507 (GRCm39) Y89C probably damaging Het
Lama3 T A 18: 12,664,936 (GRCm39) S646T probably benign Het
Lig3 T A 11: 82,688,138 (GRCm39) M709K probably benign Het
Mindy3 C A 2: 12,405,885 (GRCm39) A137S possibly damaging Het
Mis18bp1 T C 12: 65,196,057 (GRCm39) E569G possibly damaging Het
Misp T A 10: 79,662,999 (GRCm39) L472Q probably damaging Het
Mrps5 A T 2: 127,443,330 (GRCm39) T303S probably damaging Het
Msh3 T G 13: 92,411,308 (GRCm39) I630L probably benign Het
Muc21 C A 17: 35,932,432 (GRCm39) A585S unknown Het
Myo16 A G 8: 10,619,673 (GRCm39) Y1408C unknown Het
N4bp2 T C 5: 65,964,189 (GRCm39) V746A probably benign Het
Oga G A 19: 45,771,605 (GRCm39) probably benign Het
Or4c120 A G 2: 89,000,827 (GRCm39) I243T possibly damaging Het
Or4d11 A G 19: 12,013,752 (GRCm39) M118T probably damaging Het
Or5p56 A G 7: 107,589,805 (GRCm39) T78A possibly damaging Het
Ostf1 C T 19: 18,573,715 (GRCm39) M44I probably null Het
Pik3c2b T G 1: 133,033,712 (GRCm39) L1572R probably damaging Het
Pilra T C 5: 137,829,488 (GRCm39) D192G possibly damaging Het
Pkhd1l1 A G 15: 44,437,027 (GRCm39) I3462V probably benign Het
Plekhh1 A G 12: 79,113,429 (GRCm39) D619G probably benign Het
Pramel31 C T 4: 144,090,297 (GRCm39) R446C probably benign Het
Ptprb T A 10: 116,174,718 (GRCm39) Y797N probably damaging Het
Rb1 T C 14: 73,500,084 (GRCm39) D521G probably damaging Het
Rnf17 T G 14: 56,708,763 (GRCm39) F728V possibly damaging Het
Slc16a4 T C 3: 107,218,787 (GRCm39) S463P probably damaging Het
Slc4a1 A T 11: 102,244,693 (GRCm39) I634K probably damaging Het
Slc4a1ap T C 5: 31,701,201 (GRCm39) V634A probably benign Het
Spam1 A G 6: 24,800,583 (GRCm39) M441V probably benign Het
Teddm3 A C 16: 20,971,729 (GRCm39) L280* probably null Het
Tmem231 T C 8: 112,645,517 (GRCm39) probably null Het
Tom1l1 T C 11: 90,561,907 (GRCm39) probably null Het
Topors C T 4: 40,261,706 (GRCm39) G526D probably benign Het
Trpm6 A T 19: 18,790,911 (GRCm39) I649F possibly damaging Het
Ttc16 T A 2: 32,664,440 (GRCm39) M66L probably benign Het
Tubgcp6 A G 15: 88,985,232 (GRCm39) F1619L probably damaging Het
Vps13d G T 4: 144,842,062 (GRCm39) A2619E Het
Vps8 G A 16: 21,345,191 (GRCm39) R838H probably damaging Het
Vwde T A 6: 13,215,799 (GRCm39) M86L probably benign Het
Zfp64 A T 2: 168,768,357 (GRCm39) D418E probably benign Het
Zfp952 C T 17: 33,222,606 (GRCm39) P362S possibly damaging Het
Zglp1 T C 9: 20,977,368 (GRCm39) E149G probably benign Het
Other mutations in Kif23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Kif23 APN 9 61,833,750 (GRCm39) missense probably benign 0.19
IGL00814:Kif23 APN 9 61,844,389 (GRCm39) missense possibly damaging 0.95
IGL01295:Kif23 APN 9 61,839,411 (GRCm39) missense possibly damaging 0.89
IGL01521:Kif23 APN 9 61,827,182 (GRCm39) missense probably damaging 0.99
IGL01583:Kif23 APN 9 61,842,750 (GRCm39) missense probably damaging 1.00
IGL01680:Kif23 APN 9 61,839,096 (GRCm39) missense probably benign 0.17
IGL02450:Kif23 APN 9 61,831,239 (GRCm39) missense probably benign 0.00
IGL02698:Kif23 APN 9 61,832,283 (GRCm39) missense possibly damaging 0.49
IGL03152:Kif23 APN 9 61,837,058 (GRCm39) splice site probably benign
IGL03233:Kif23 APN 9 61,833,735 (GRCm39) missense probably benign 0.05
H8562:Kif23 UTSW 9 61,831,347 (GRCm39) missense probably benign
R0225:Kif23 UTSW 9 61,832,976 (GRCm39) splice site probably benign
R0419:Kif23 UTSW 9 61,833,687 (GRCm39) nonsense probably null
R0512:Kif23 UTSW 9 61,826,257 (GRCm39) splice site probably benign
R0731:Kif23 UTSW 9 61,832,314 (GRCm39) missense possibly damaging 0.67
R0980:Kif23 UTSW 9 61,844,046 (GRCm39) missense possibly damaging 0.93
R1315:Kif23 UTSW 9 61,831,270 (GRCm39) splice site probably null
R1347:Kif23 UTSW 9 61,834,438 (GRCm39) missense probably damaging 0.99
R1347:Kif23 UTSW 9 61,834,438 (GRCm39) missense probably damaging 0.99
R1451:Kif23 UTSW 9 61,832,084 (GRCm39) missense probably damaging 1.00
R1624:Kif23 UTSW 9 61,832,982 (GRCm39) splice site probably null
R1820:Kif23 UTSW 9 61,833,720 (GRCm39) missense possibly damaging 0.67
R1867:Kif23 UTSW 9 61,826,243 (GRCm39) missense possibly damaging 0.87
R1937:Kif23 UTSW 9 61,853,892 (GRCm39) critical splice donor site probably null
R2001:Kif23 UTSW 9 61,834,666 (GRCm39) nonsense probably null
R2002:Kif23 UTSW 9 61,834,666 (GRCm39) nonsense probably null
R2310:Kif23 UTSW 9 61,831,426 (GRCm39) missense probably damaging 1.00
R2680:Kif23 UTSW 9 61,844,758 (GRCm39) missense probably benign 0.25
R3196:Kif23 UTSW 9 61,839,193 (GRCm39) nonsense probably null
R3774:Kif23 UTSW 9 61,832,274 (GRCm39) missense probably benign 0.00
R3775:Kif23 UTSW 9 61,832,274 (GRCm39) missense probably benign 0.00
R3776:Kif23 UTSW 9 61,832,274 (GRCm39) missense probably benign 0.00
R4349:Kif23 UTSW 9 61,839,396 (GRCm39) missense probably damaging 1.00
R4671:Kif23 UTSW 9 61,852,641 (GRCm39) missense probably benign 0.04
R4981:Kif23 UTSW 9 61,839,153 (GRCm39) missense probably damaging 1.00
R4983:Kif23 UTSW 9 61,843,985 (GRCm39) missense probably benign 0.01
R5685:Kif23 UTSW 9 61,852,691 (GRCm39) missense probably benign 0.12
R5721:Kif23 UTSW 9 61,851,498 (GRCm39) missense probably benign 0.45
R6903:Kif23 UTSW 9 61,834,436 (GRCm39) missense possibly damaging 0.77
R7067:Kif23 UTSW 9 61,832,271 (GRCm39) missense probably benign 0.01
R7456:Kif23 UTSW 9 61,844,402 (GRCm39) missense probably benign 0.09
R7468:Kif23 UTSW 9 61,844,457 (GRCm39) nonsense probably null
R8357:Kif23 UTSW 9 61,834,317 (GRCm39) critical splice donor site probably null
R8457:Kif23 UTSW 9 61,834,317 (GRCm39) critical splice donor site probably null
R8716:Kif23 UTSW 9 61,844,477 (GRCm39) missense probably damaging 1.00
R8783:Kif23 UTSW 9 61,834,853 (GRCm39) missense probably benign 0.00
R9028:Kif23 UTSW 9 61,828,341 (GRCm39) missense probably damaging 0.99
R9137:Kif23 UTSW 9 61,834,713 (GRCm39) missense probably damaging 0.97
R9283:Kif23 UTSW 9 61,852,651 (GRCm39) missense probably benign
R9430:Kif23 UTSW 9 61,834,722 (GRCm39) missense probably damaging 1.00
R9457:Kif23 UTSW 9 61,851,507 (GRCm39) missense probably benign 0.02
R9533:Kif23 UTSW 9 61,832,924 (GRCm39) missense probably benign
Z1177:Kif23 UTSW 9 61,831,445 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCTAGGGTGGACGATCTTC -3'
(R):5'- AATTCAGCAGCTCGAGGGTC -3'

Sequencing Primer
(F):5'- CTTCGTTTCCGACTACTGAAAAAGGG -3'
(R):5'- CAGCAGCTCGAGGGTCTTTTG -3'
Posted On 2019-05-15