Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Kif23'

550996

Institutional Source

Beutler Lab

Gene Symbol

Kif23

Ensembl Gene

ENSMUSG00000032254

Gene Name

kinesin family member 23

Synonyms

MKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61915905-61946774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 61919892 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 892 (K892N)

Ref Sequence

ENSEMBL: ENSMUSP00000034815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034815]

AlphaFold

E9Q5G3

Predicted Effect

probably damaging
Transcript: ENSMUST00000034815
AA Change: K892N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: K892N

Domain	Start	End	E-Value	Type
KISc	23	444	6.56e-147	SMART
Blast:KISc	524	607	8e-20	BLAST
low complexity region	661	678	N/A	INTRINSIC
low complexity region	681	693	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
Pfam:MKLP1_Arf_bdg	796	899	9.2e-47	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Kif23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Kif23	APN	9	61926468	missense	probably benign	0.19
IGL00814:Kif23	APN	9	61937107	missense	possibly damaging	0.95
IGL01295:Kif23	APN	9	61932129	missense	possibly damaging	0.89
IGL01521:Kif23	APN	9	61919900	missense	probably damaging	0.99
IGL01583:Kif23	APN	9	61935468	missense	probably damaging	1.00
IGL01680:Kif23	APN	9	61931814	missense	probably benign	0.17
IGL02450:Kif23	APN	9	61923957	missense	probably benign	0.00
IGL02698:Kif23	APN	9	61925001	missense	possibly damaging	0.49
IGL03152:Kif23	APN	9	61929776	splice site	probably benign
IGL03233:Kif23	APN	9	61926453	missense	probably benign	0.05
H8562:Kif23	UTSW	9	61924065	missense	probably benign
R0225:Kif23	UTSW	9	61925694	splice site	probably benign
R0419:Kif23	UTSW	9	61926405	nonsense	probably null
R0512:Kif23	UTSW	9	61918975	splice site	probably benign
R0731:Kif23	UTSW	9	61925032	missense	possibly damaging	0.67
R0980:Kif23	UTSW	9	61936764	missense	possibly damaging	0.93
R1315:Kif23	UTSW	9	61923988	splice site	probably null
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1451:Kif23	UTSW	9	61924802	missense	probably damaging	1.00
R1624:Kif23	UTSW	9	61925700	splice site	probably null
R1820:Kif23	UTSW	9	61926438	missense	possibly damaging	0.67
R1867:Kif23	UTSW	9	61918961	missense	possibly damaging	0.87
R1937:Kif23	UTSW	9	61946610	critical splice donor site	probably null
R2001:Kif23	UTSW	9	61927384	nonsense	probably null
R2002:Kif23	UTSW	9	61927384	nonsense	probably null
R2310:Kif23	UTSW	9	61924144	missense	probably damaging	1.00
R2680:Kif23	UTSW	9	61937476	missense	probably benign	0.25
R3196:Kif23	UTSW	9	61931911	nonsense	probably null
R3774:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3775:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3776:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R4349:Kif23	UTSW	9	61932114	missense	probably damaging	1.00
R4671:Kif23	UTSW	9	61945359	missense	probably benign	0.04
R4981:Kif23	UTSW	9	61931871	missense	probably damaging	1.00
R4983:Kif23	UTSW	9	61936703	missense	probably benign	0.01
R5685:Kif23	UTSW	9	61945409	missense	probably benign	0.12
R5721:Kif23	UTSW	9	61944216	missense	probably benign	0.45
R6903:Kif23	UTSW	9	61927154	missense	possibly damaging	0.77
R7067:Kif23	UTSW	9	61924989	missense	probably benign	0.01
R7456:Kif23	UTSW	9	61937120	missense	probably benign	0.09
R7468:Kif23	UTSW	9	61937175	nonsense	probably null
R8357:Kif23	UTSW	9	61927035	critical splice donor site	probably null
R8457:Kif23	UTSW	9	61927035	critical splice donor site	probably null
R8716:Kif23	UTSW	9	61937195	missense	probably damaging	1.00
R8783:Kif23	UTSW	9	61927571	missense	probably benign	0.00
R9028:Kif23	UTSW	9	61921059	missense	probably damaging	0.99
R9137:Kif23	UTSW	9	61927431	missense	probably damaging	0.97
R9283:Kif23	UTSW	9	61945369	missense	probably benign
R9430:Kif23	UTSW	9	61927440	missense	probably damaging	1.00
R9457:Kif23	UTSW	9	61944225	missense	probably benign	0.02
R9533:Kif23	UTSW	9	61925642	missense	probably benign
Z1177:Kif23	UTSW	9	61924163	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTAGGGTGGACGATCTTC -3'
(R):5'- AATTCAGCAGCTCGAGGGTC -3'

Sequencing Primer
(F):5'- CTTCGTTTCCGACTACTGAAAAAGGG -3'
(R):5'- CAGCAGCTCGAGGGTCTTTTG -3'

Posted On

2019-05-15