Incidental Mutation 'R7103:Kcnmb4'
List |< first << previous [record 24 of 64] next >> last >|
ID551001
Institutional Source Beutler Lab
Gene Symbol Kcnmb4
Ensembl Gene ENSMUSG00000054934
Gene Namepotassium large conductance calcium-activated channel, subfamily M, beta member 4
Synonyms2900045G12Rik, Slowpoke beta 4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116417861-116473878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116473259 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 88 (Y88C)
Ref Sequence ENSEMBL: ENSMUSP00000065384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068233]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068233
AA Change: Y88C

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065384
Gene: ENSMUSG00000054934
AA Change: Y88C

DomainStartEndE-ValueType
Pfam:CaKB 8 203 2.7e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which slows activation kinetics, leads to steeper calcium sensitivity, and shifts the voltage range of current activation to more negative potentials than does the beta 1 subunit. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Lig3 T A 11: 82,797,312 M709K probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Kcnmb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Kcnmb4 APN 10 116473346 missense probably benign 0.34
IGL02016:Kcnmb4 APN 10 116446462 splice site probably benign
R1499:Kcnmb4 UTSW 10 116473298 missense possibly damaging 0.52
R4355:Kcnmb4 UTSW 10 116473284 missense possibly damaging 0.57
R4361:Kcnmb4 UTSW 10 116473505 missense probably benign 0.13
R5058:Kcnmb4 UTSW 10 116463928 intron probably benign
R5074:Kcnmb4 UTSW 10 116473197 missense probably benign 0.00
R5463:Kcnmb4 UTSW 10 116473505 missense probably benign 0.13
R6562:Kcnmb4 UTSW 10 116473184 critical splice donor site probably null
R6883:Kcnmb4 UTSW 10 116473343 missense probably benign 0.00
R7486:Kcnmb4 UTSW 10 116418275 missense probably benign 0.13
R8284:Kcnmb4 UTSW 10 116418253 missense probably damaging 1.00
R8324:Kcnmb4 UTSW 10 116418314 missense probably damaging 1.00
R8377:Kcnmb4 UTSW 10 116446385 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCTGTTTGCAGAGAGGCTCG -3'
(R):5'- AGGGTGTCTTACGAGTACACG -3'

Sequencing Primer
(F):5'- TTTGCAGAGAGGCTCGCGTAC -3'
(R):5'- CCGAAGACAAGAGCATCCGG -3'
Posted On2019-05-15