Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Adamts2'

551002

Institutional Source

Beutler Lab

Gene Symbol

Adamts2

Ensembl Gene

ENSMUSG00000036545

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2

Synonyms

ADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50602084-50807573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 50737354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 294 (T294A)

Ref Sequence

ENSEMBL: ENSMUSP00000040171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040523]

AlphaFold

Q8C9W3

Predicted Effect

probably damaging
Transcript: ENSMUST00000040523
AA Change: T294A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000040171
Gene: ENSMUSG00000036545
AA Change: T294A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	44	52	N/A	INTRINSIC
Pfam:Pep_M12B_propep	56	211	2.6e-39	PFAM
low complexity region	214	225	N/A	INTRINSIC
coiled coil region	236	260	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	1.4e-15	PFAM
Pfam:Reprolysin_4	267	464	7.1e-11	PFAM
Pfam:Reprolysin	268	471	2.4e-20	PFAM
Pfam:Reprolysin_2	285	463	9.1e-14	PFAM
Pfam:Reprolysin_3	289	420	8.7e-13	PFAM
TSP1	565	617	9.73e-17	SMART
Pfam:ADAM_spacer1	724	838	5.1e-33	PFAM
low complexity region	839	853	N/A	INTRINSIC
TSP1	858	915	1.05e-3	SMART
TSP1	918	977	2.78e-3	SMART
TSP1	980	1030	4.99e-5	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin repeats) family of proteinases that is involved in the proteolytic processing of procollagens. The encoded protein precursor is proteolytically processed to generate a mature, zinc-dependent enzyme. Mice lacking the encoded protein develop abnormal lungs, fragile skin and male sterility. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutation of this gene results in a short snout, male infertility, and thin skin that is torn by scratching or handling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Lig3	T	A	11: 82,797,312	M709K	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Adamts2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01309:Adamts2	APN	11	50803701	missense	probably benign	0.00
IGL01366:Adamts2	APN	11	50796468	missense	probably damaging	1.00
IGL01412:Adamts2	APN	11	50795403	missense	probably benign	0.43
IGL01443:Adamts2	APN	11	50803863	missense	possibly damaging	0.54
IGL01974:Adamts2	APN	11	50776174	missense	probably damaging	0.99
IGL02267:Adamts2	APN	11	50792678	missense	probably benign	0.00
IGL02498:Adamts2	APN	11	50773308	missense	possibly damaging	0.81
IGL02498:Adamts2	APN	11	50777196	missense	probably damaging	1.00
IGL02626:Adamts2	APN	11	50776255	missense	probably damaging	0.99
IGL02634:Adamts2	APN	11	50792721	nonsense	probably null
IGL02643:Adamts2	APN	11	50788700	missense	probably benign	0.01
IGL02836:Adamts2	APN	11	50787279	missense	probably damaging	1.00
IGL03012:Adamts2	APN	11	50776269	splice site	probably benign
ANU22:Adamts2	UTSW	11	50737363	missense	probably benign	0.06
H8441:Adamts2	UTSW	11	50784678	missense	probably damaging	1.00
R0050:Adamts2	UTSW	11	50775395	missense	probably damaging	1.00
R0050:Adamts2	UTSW	11	50775395	missense	probably damaging	1.00
R0240:Adamts2	UTSW	11	50775374	missense	probably damaging	1.00
R0240:Adamts2	UTSW	11	50775374	missense	probably damaging	1.00
R0491:Adamts2	UTSW	11	50776630	missense	probably damaging	0.98
R0501:Adamts2	UTSW	11	50668145	missense	probably benign	0.16
R0570:Adamts2	UTSW	11	50776136	missense	probably damaging	1.00
R0588:Adamts2	UTSW	11	50776664	missense	probably damaging	1.00
R0647:Adamts2	UTSW	11	50603438	missense	probably damaging	1.00
R0760:Adamts2	UTSW	11	50775326	missense	probably damaging	1.00
R0784:Adamts2	UTSW	11	50668003	missense	probably damaging	1.00
R1163:Adamts2	UTSW	11	50779714	missense	probably damaging	1.00
R1623:Adamts2	UTSW	11	50668115	missense	possibly damaging	0.79
R1641:Adamts2	UTSW	11	50792785	missense	probably damaging	1.00
R1779:Adamts2	UTSW	11	50756697	missense	probably damaging	0.99
R2163:Adamts2	UTSW	11	50788805	missense	probably benign	0.36
R2177:Adamts2	UTSW	11	50777228	missense	probably damaging	0.98
R2508:Adamts2	UTSW	11	50788689	missense	possibly damaging	0.82
R3721:Adamts2	UTSW	11	50773211	splice site	probably benign
R4092:Adamts2	UTSW	11	50787276	missense	probably damaging	0.99
R4691:Adamts2	UTSW	11	50756696	missense	probably damaging	1.00
R4785:Adamts2	UTSW	11	50792722	missense	probably benign	0.00
R4809:Adamts2	UTSW	11	50803690	missense	probably benign	0.17
R4823:Adamts2	UTSW	11	50737187	missense	probably benign	0.26
R4927:Adamts2	UTSW	11	50803812	nonsense	probably null
R4976:Adamts2	UTSW	11	50737366	missense	possibly damaging	0.67
R5118:Adamts2	UTSW	11	50781869	missense	probably damaging	0.99
R5478:Adamts2	UTSW	11	50792651	missense	possibly damaging	0.83
R5660:Adamts2	UTSW	11	50776645	missense	probably damaging	1.00
R5734:Adamts2	UTSW	11	50788667	missense	probably damaging	1.00
R5865:Adamts2	UTSW	11	50803954	nonsense	probably null
R6079:Adamts2	UTSW	11	50756706	missense	probably damaging	1.00
R6138:Adamts2	UTSW	11	50756706	missense	probably damaging	1.00
R6257:Adamts2	UTSW	11	50775326	missense	probably damaging	1.00
R6540:Adamts2	UTSW	11	50788740	missense	possibly damaging	0.77
R6897:Adamts2	UTSW	11	50737164	critical splice acceptor site	probably null
R7229:Adamts2	UTSW	11	50791820	missense	probably damaging	1.00
R7261:Adamts2	UTSW	11	50786597	missense	possibly damaging	0.48
R7335:Adamts2	UTSW	11	50602266	missense	probably benign	0.18
R7373:Adamts2	UTSW	11	50795435	missense	probably benign	0.00
R7505:Adamts2	UTSW	11	50796520	missense	probably benign	0.00
R7971:Adamts2	UTSW	11	50756696	missense	probably damaging	1.00
R8081:Adamts2	UTSW	11	50777177	missense	probably damaging	0.99
R8167:Adamts2	UTSW	11	50779714	missense	probably damaging	1.00
R8256:Adamts2	UTSW	11	50792756	missense	probably benign	0.41
R8298:Adamts2	UTSW	11	50777131	missense	possibly damaging	0.91
R8343:Adamts2	UTSW	11	50603488	missense	probably damaging	1.00
R8518:Adamts2	UTSW	11	50776130	missense	probably damaging	1.00
R8716:Adamts2	UTSW	11	50773264	missense	probably damaging	1.00
R8865:Adamts2	UTSW	11	50781744	nonsense	probably null
R8968:Adamts2	UTSW	11	50792723	missense	possibly damaging	0.72
R9436:Adamts2	UTSW	11	50803680	missense	probably benign	0.00
R9694:Adamts2	UTSW	11	50668145	missense	probably benign	0.16
R9720:Adamts2	UTSW	11	50776127	missense	probably damaging	0.97
R9750:Adamts2	UTSW	11	50603506	missense	probably benign	0.00
U15987:Adamts2	UTSW	11	50756706	missense	probably damaging	1.00
X0065:Adamts2	UTSW	11	50803649	nonsense	probably null
Z1176:Adamts2	UTSW	11	50792708	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGGCTACCAAAGAAGGTGTC -3'
(R):5'- TCCAGCCCAATTCGCCAATG -3'

Sequencing Primer
(F):5'- GGCTACCAAAGAAGGTGTCCTTTC -3'
(R):5'- GCCAATGTCCTACTCTCTGATGGAC -3'

Posted On

2019-05-15