Incidental Mutation 'R7103:Lig3'
ID551003
Institutional Source Beutler Lab
Gene Symbol Lig3
Ensembl Gene ENSMUSG00000020697
Gene Nameligase III, DNA, ATP-dependent
SynonymsD11Wsu78e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7103 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82781108-82804274 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82797312 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 709 (M709K)
Ref Sequence ENSEMBL: ENSMUSP00000090525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021039] [ENSMUST00000080461] [ENSMUST00000092849] [ENSMUST00000172837] [ENSMUST00000173347] [ENSMUST00000173722] [ENSMUST00000173727]
Predicted Effect probably benign
Transcript: ENSMUST00000021039
AA Change: M713K

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697
AA Change: M713K

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 265 440 3.5e-34 PFAM
Pfam:DNA_ligase_A_M 489 683 3.9e-65 PFAM
Pfam:DNA_ligase_A_C 710 820 3.8e-21 PFAM
low complexity region 855 885 N/A INTRINSIC
BRCT 942 1010 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080461
AA Change: M709K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697
AA Change: M709K

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 6.8e-53 PFAM
Pfam:DNA_ligase_A_M 485 679 1.3e-63 PFAM
Pfam:DNA_ligase_A_C 706 816 3.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092849
AA Change: M709K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697
AA Change: M709K

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172837
SMART Domains Protein: ENSMUSP00000134101
Gene: ENSMUSG00000020697

DomainStartEndE-ValueType
PDB:3L2P|A 1 25 8e-9 PDB
low complexity region 41 71 N/A INTRINSIC
PDB:3QVG|C 115 173 2e-29 PDB
SCOP:d1in1a_ 116 172 3e-34 SMART
Blast:BRCT 128 173 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173347
AA Change: M708K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697
AA Change: M708K

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173722
AA Change: M709K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697
AA Change: M709K

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 263 437 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 485 679 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 706 816 2.2e-21 PFAM
low complexity region 851 881 N/A INTRINSIC
BRCT 938 1006 9.77e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173727
AA Change: M708K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697
AA Change: M708K

DomainStartEndE-ValueType
zf-PARP 97 183 8.89e-32 SMART
low complexity region 188 202 N/A INTRINSIC
Pfam:DNA_ligase_A_N 262 436 1.4e-52 PFAM
Pfam:DNA_ligase_A_M 484 678 7.2e-64 PFAM
Pfam:DNA_ligase_A_C 705 815 2.2e-21 PFAM
low complexity region 850 880 N/A INTRINSIC
BRCT 937 1005 9.77e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene causes embryonic growth arrest at 8.5 dpc, followed by excessive apoptosis at 9.5 dpc, and ultimately death, likely due to unrepaired DNA damage. Homozygous mutant cells display elevated sister chromatid exchange. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,737,354 T294A probably damaging Het
Adamtsl2 G A 2: 27,107,461 V893I probably damaging Het
Amph T A 13: 19,149,738 D656E probably benign Het
Aoah T C 13: 21,023,315 F568S probably damaging Het
Atr G A 9: 95,865,372 G236S probably damaging Het
Brd3 T A 2: 27,450,394 Q601L probably damaging Het
Ccar2 T C 14: 70,141,977 E524G probably damaging Het
Cog2 T C 8: 124,541,114 probably null Het
Csnka2ip C A 16: 64,478,757 V415F unknown Het
Dmp1 A T 5: 104,211,863 D135V probably damaging Het
Dtna T C 18: 23,653,379 probably null Het
Endou A G 15: 97,718,929 S238P probably damaging Het
Ep400 T A 5: 110,733,785 E779D unknown Het
Fcgbp A G 7: 28,084,962 E149G probably benign Het
G6pc C A 11: 101,374,587 probably null Het
Gm13119 C T 4: 144,363,727 R446C probably benign Het
Gm9573 C A 17: 35,621,540 A585S unknown Het
Gmeb1 T C 4: 132,234,868 H160R probably damaging Het
Gramd1b T C 9: 40,401,606 Y22C unknown Het
Hcrtr2 C T 9: 76,254,511 G199D probably benign Het
Hoxb2 T C 11: 96,353,621 F353L possibly damaging Het
Itpr2 C A 6: 146,325,074 V1391F probably damaging Het
Jakmip2 T A 18: 43,540,583 probably null Het
Kcnmb4 T C 10: 116,473,259 Y88C possibly damaging Het
Kif1a T C 1: 93,077,785 Y89C probably damaging Het
Kif23 T A 9: 61,919,892 K892N probably damaging Het
Lama3 T A 18: 12,531,879 S646T probably benign Het
Mgea5 G A 19: 45,783,166 probably benign Het
Mindy3 C A 2: 12,401,074 A137S possibly damaging Het
Mis18bp1 T C 12: 65,149,283 E569G possibly damaging Het
Misp T A 10: 79,827,165 L472Q probably damaging Het
Mrps5 A T 2: 127,601,410 T303S probably damaging Het
Msh3 T G 13: 92,274,800 I630L probably benign Het
Myo16 A G 8: 10,569,673 Y1408C unknown Het
N4bp2 T C 5: 65,806,846 V746A probably benign Het
Olfr1225 A G 2: 89,170,483 I243T possibly damaging Het
Olfr1423 A G 19: 12,036,388 M118T probably damaging Het
Olfr477 A G 7: 107,990,598 T78A possibly damaging Het
Ostf1 C T 19: 18,596,351 M44I probably null Het
Pik3c2b T G 1: 133,105,974 L1572R probably damaging Het
Pilra T C 5: 137,831,226 D192G possibly damaging Het
Pkhd1l1 A G 15: 44,573,631 I3462V probably benign Het
Plekhh1 A G 12: 79,066,655 D619G probably benign Het
Ptprb T A 10: 116,338,813 Y797N probably damaging Het
Rb1 T C 14: 73,262,644 D521G probably damaging Het
Rnf17 T G 14: 56,471,306 F728V possibly damaging Het
Slc16a4 T C 3: 107,311,471 S463P probably damaging Het
Slc4a1 A T 11: 102,353,867 I634K probably damaging Het
Slc4a1ap T C 5: 31,543,857 V634A probably benign Het
Spam1 A G 6: 24,800,584 M441V probably benign Het
Teddm3 A C 16: 21,152,979 L280* probably null Het
Tmem231 T C 8: 111,918,885 probably null Het
Tom1l1 T C 11: 90,671,081 probably null Het
Topors C T 4: 40,261,706 G526D probably benign Het
Trpm6 A T 19: 18,813,547 I649F possibly damaging Het
Ttc16 T A 2: 32,774,428 M66L probably benign Het
Tubgcp6 A G 15: 89,101,029 F1619L probably damaging Het
Vps13d G T 4: 145,115,492 A2619E Het
Vps8 G A 16: 21,526,441 R838H probably damaging Het
Vwde T A 6: 13,215,800 M86L probably benign Het
Zfp64 A T 2: 168,926,437 D418E probably benign Het
Zfp952 C T 17: 33,003,632 P362S possibly damaging Het
Zglp1 T C 9: 21,066,072 E149G probably benign Het
Other mutations in Lig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Lig3 APN 11 82797315 missense possibly damaging 0.90
IGL01577:Lig3 APN 11 82783477 missense probably benign 0.00
IGL01643:Lig3 APN 11 82798292 missense probably damaging 1.00
IGL01712:Lig3 APN 11 82789541 splice site probably benign
IGL01724:Lig3 APN 11 82790622 missense possibly damaging 0.95
IGL01749:Lig3 APN 11 82789867 missense probably damaging 1.00
IGL01778:Lig3 APN 11 82794541 missense probably damaging 1.00
IGL02798:Lig3 APN 11 82795705 splice site probably benign
IGL03007:Lig3 APN 11 82789575 missense probably damaging 1.00
IGL03178:Lig3 APN 11 82789722 splice site probably benign
R0001:Lig3 UTSW 11 82790591 missense probably damaging 1.00
R0115:Lig3 UTSW 11 82793935 missense probably damaging 1.00
R0834:Lig3 UTSW 11 82798287 missense probably damaging 0.99
R1460:Lig3 UTSW 11 82795798 splice site probably benign
R1602:Lig3 UTSW 11 82792194 critical splice donor site probably null
R1969:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1971:Lig3 UTSW 11 82795718 missense probably benign 0.14
R1997:Lig3 UTSW 11 82787666 missense probably benign 0.00
R3817:Lig3 UTSW 11 82796115 missense possibly damaging 0.75
R4083:Lig3 UTSW 11 82790494 missense probably benign 0.31
R4084:Lig3 UTSW 11 82795424 missense probably damaging 1.00
R4665:Lig3 UTSW 11 82800250 missense probably damaging 0.99
R4737:Lig3 UTSW 11 82787727 missense probably damaging 1.00
R5212:Lig3 UTSW 11 82787678 missense probably benign
R5274:Lig3 UTSW 11 82797292 splice site probably null
R6320:Lig3 UTSW 11 82794007 critical splice donor site probably null
R6807:Lig3 UTSW 11 82783751 missense probably benign 0.00
R7552:Lig3 UTSW 11 82788891 missense probably benign 0.00
R7646:Lig3 UTSW 11 82783478 missense probably benign 0.00
R7910:Lig3 UTSW 11 82797775 missense probably damaging 0.99
R7966:Lig3 UTSW 11 82790516 missense probably damaging 1.00
R8001:Lig3 UTSW 11 82792076 missense probably benign 0.18
R8436:Lig3 UTSW 11 82792044 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGGAGCCCAGTAAGTCAAGTG -3'
(R):5'- AGAACAACTTGCCCAGGCTG -3'

Sequencing Primer
(F):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
(R):5'- TGAGGGGCTACCAGGTG -3'
Posted On2019-05-15