Mutagenetix > Incidental Mutation

Incidental Mutation 'R7103:Lig3'

551003

Institutional Source

Beutler Lab

Gene Symbol

Lig3

Ensembl Gene

ENSMUSG00000020697

Gene Name

ligase III, DNA, ATP-dependent

Synonyms

D11Wsu78e

MMRRC Submission

045195-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7103 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82781108-82804274 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 82797312 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 709 (M709K)

Ref Sequence

ENSEMBL: ENSMUSP00000090525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021039] [ENSMUST00000080461] [ENSMUST00000092849] [ENSMUST00000172837] [ENSMUST00000173347] [ENSMUST00000173722] [ENSMUST00000173727]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000021039
AA Change: M713K

PolyPhen 2 Score 0.319 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000021039
Gene: ENSMUSG00000020697
AA Change: M713K

Domain	Start	End	E-Value	Type
zf-PARP	97	183	8.89e-32	SMART
low complexity region	188	202	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	265	440	3.5e-34	PFAM
Pfam:DNA_ligase_A_M	489	683	3.9e-65	PFAM
Pfam:DNA_ligase_A_C	710	820	3.8e-21	PFAM
low complexity region	855	885	N/A	INTRINSIC
BRCT	942	1010	9.77e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000080461
AA Change: M709K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000079317
Gene: ENSMUSG00000020697
AA Change: M709K

Domain	Start	End	E-Value	Type
zf-PARP	97	183	8.89e-32	SMART
low complexity region	188	202	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	263	437	6.8e-53	PFAM
Pfam:DNA_ligase_A_M	485	679	1.3e-63	PFAM
Pfam:DNA_ligase_A_C	706	816	3.2e-21	PFAM
low complexity region	851	881	N/A	INTRINSIC
low complexity region	934	946	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092849
AA Change: M709K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000090525
Gene: ENSMUSG00000020697
AA Change: M709K

Domain	Start	End	E-Value	Type
zf-PARP	97	183	8.89e-32	SMART
low complexity region	188	202	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	263	437	1.4e-52	PFAM
Pfam:DNA_ligase_A_M	485	679	7.2e-64	PFAM
Pfam:DNA_ligase_A_C	706	816	2.2e-21	PFAM
low complexity region	851	881	N/A	INTRINSIC
BRCT	938	1006	9.77e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172837

SMART Domains

Protein: ENSMUSP00000134101
Gene: ENSMUSG00000020697

Domain	Start	End	E-Value	Type
PDB:3L2P\|A	1	25	8e-9	PDB
low complexity region	41	71	N/A	INTRINSIC
PDB:3QVG\|C	115	173	2e-29	PDB
SCOP:d1in1a_	116	172	3e-34	SMART
Blast:BRCT	128	173	2e-25	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000173347
AA Change: M708K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000134300
Gene: ENSMUSG00000020697
AA Change: M708K

Domain	Start	End	E-Value	Type
zf-PARP	97	183	8.89e-32	SMART
low complexity region	188	202	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	262	436	1.4e-52	PFAM
Pfam:DNA_ligase_A_M	484	678	7.2e-64	PFAM
Pfam:DNA_ligase_A_C	705	815	2.2e-21	PFAM
low complexity region	850	880	N/A	INTRINSIC
BRCT	937	1005	9.77e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173722
AA Change: M709K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133805
Gene: ENSMUSG00000020697
AA Change: M709K

Domain	Start	End	E-Value	Type
zf-PARP	97	183	8.89e-32	SMART
low complexity region	188	202	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	263	437	1.4e-52	PFAM
Pfam:DNA_ligase_A_M	485	679	7.2e-64	PFAM
Pfam:DNA_ligase_A_C	706	816	2.2e-21	PFAM
low complexity region	851	881	N/A	INTRINSIC
BRCT	938	1006	9.77e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173727
AA Change: M708K

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133849
Gene: ENSMUSG00000020697
AA Change: M708K

Domain	Start	End	E-Value	Type
zf-PARP	97	183	8.89e-32	SMART
low complexity region	188	202	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	262	436	1.4e-52	PFAM
Pfam:DNA_ligase_A_M	484	678	7.2e-64	PFAM
Pfam:DNA_ligase_A_C	705	815	2.2e-21	PFAM
low complexity region	850	880	N/A	INTRINSIC
BRCT	937	1005	9.77e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene causes embryonic growth arrest at 8.5 dpc, followed by excessive apoptosis at 9.5 dpc, and ultimately death, likely due to unrepaired DNA damage. Homozygous mutant cells display elevated sister chromatid exchange. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	A	G	11: 50,737,354	T294A	probably damaging	Het
Adamtsl2	G	A	2: 27,107,461	V893I	probably damaging	Het
Amph	T	A	13: 19,149,738	D656E	probably benign	Het
Aoah	T	C	13: 21,023,315	F568S	probably damaging	Het
Atr	G	A	9: 95,865,372	G236S	probably damaging	Het
Brd3	T	A	2: 27,450,394	Q601L	probably damaging	Het
Ccar2	T	C	14: 70,141,977	E524G	probably damaging	Het
Cog2	T	C	8: 124,541,114		probably null	Het
Csnka2ip	C	A	16: 64,478,757	V415F	unknown	Het
Dmp1	A	T	5: 104,211,863	D135V	probably damaging	Het
Dtna	T	C	18: 23,653,379		probably null	Het
Endou	A	G	15: 97,718,929	S238P	probably damaging	Het
Ep400	T	A	5: 110,733,785	E779D	unknown	Het
Fcgbp	A	G	7: 28,084,962	E149G	probably benign	Het
G6pc	C	A	11: 101,374,587		probably null	Het
Gm13119	C	T	4: 144,363,727	R446C	probably benign	Het
Gm9573	C	A	17: 35,621,540	A585S	unknown	Het
Gmeb1	T	C	4: 132,234,868	H160R	probably damaging	Het
Gramd1b	T	C	9: 40,401,606	Y22C	unknown	Het
Hcrtr2	C	T	9: 76,254,511	G199D	probably benign	Het
Hoxb2	T	C	11: 96,353,621	F353L	possibly damaging	Het
Itpr2	C	A	6: 146,325,074	V1391F	probably damaging	Het
Jakmip2	T	A	18: 43,540,583		probably null	Het
Kcnmb4	T	C	10: 116,473,259	Y88C	possibly damaging	Het
Kif1a	T	C	1: 93,077,785	Y89C	probably damaging	Het
Kif23	T	A	9: 61,919,892	K892N	probably damaging	Het
Lama3	T	A	18: 12,531,879	S646T	probably benign	Het
Mgea5	G	A	19: 45,783,166		probably benign	Het
Mindy3	C	A	2: 12,401,074	A137S	possibly damaging	Het
Mis18bp1	T	C	12: 65,149,283	E569G	possibly damaging	Het
Misp	T	A	10: 79,827,165	L472Q	probably damaging	Het
Mrps5	A	T	2: 127,601,410	T303S	probably damaging	Het
Msh3	T	G	13: 92,274,800	I630L	probably benign	Het
Myo16	A	G	8: 10,569,673	Y1408C	unknown	Het
N4bp2	T	C	5: 65,806,846	V746A	probably benign	Het
Olfr1225	A	G	2: 89,170,483	I243T	possibly damaging	Het
Olfr1423	A	G	19: 12,036,388	M118T	probably damaging	Het
Olfr477	A	G	7: 107,990,598	T78A	possibly damaging	Het
Ostf1	C	T	19: 18,596,351	M44I	probably null	Het
Pik3c2b	T	G	1: 133,105,974	L1572R	probably damaging	Het
Pilra	T	C	5: 137,831,226	D192G	possibly damaging	Het
Pkhd1l1	A	G	15: 44,573,631	I3462V	probably benign	Het
Plekhh1	A	G	12: 79,066,655	D619G	probably benign	Het
Ptprb	T	A	10: 116,338,813	Y797N	probably damaging	Het
Rb1	T	C	14: 73,262,644	D521G	probably damaging	Het
Rnf17	T	G	14: 56,471,306	F728V	possibly damaging	Het
Slc16a4	T	C	3: 107,311,471	S463P	probably damaging	Het
Slc4a1	A	T	11: 102,353,867	I634K	probably damaging	Het
Slc4a1ap	T	C	5: 31,543,857	V634A	probably benign	Het
Spam1	A	G	6: 24,800,584	M441V	probably benign	Het
Teddm3	A	C	16: 21,152,979	L280*	probably null	Het
Tmem231	T	C	8: 111,918,885		probably null	Het
Tom1l1	T	C	11: 90,671,081		probably null	Het
Topors	C	T	4: 40,261,706	G526D	probably benign	Het
Trpm6	A	T	19: 18,813,547	I649F	possibly damaging	Het
Ttc16	T	A	2: 32,774,428	M66L	probably benign	Het
Tubgcp6	A	G	15: 89,101,029	F1619L	probably damaging	Het
Vps13d	G	T	4: 145,115,492	A2619E		Het
Vps8	G	A	16: 21,526,441	R838H	probably damaging	Het
Vwde	T	A	6: 13,215,800	M86L	probably benign	Het
Zfp64	A	T	2: 168,926,437	D418E	probably benign	Het
Zfp952	C	T	17: 33,003,632	P362S	possibly damaging	Het
Zglp1	T	C	9: 21,066,072	E149G	probably benign	Het

Other mutations in Lig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Lig3	APN	11	82797315	missense	possibly damaging	0.90
IGL01577:Lig3	APN	11	82783477	missense	probably benign	0.00
IGL01643:Lig3	APN	11	82798292	missense	probably damaging	1.00
IGL01712:Lig3	APN	11	82789541	splice site	probably benign
IGL01724:Lig3	APN	11	82790622	missense	possibly damaging	0.95
IGL01749:Lig3	APN	11	82789867	missense	probably damaging	1.00
IGL01778:Lig3	APN	11	82794541	missense	probably damaging	1.00
IGL02798:Lig3	APN	11	82795705	splice site	probably benign
IGL03007:Lig3	APN	11	82789575	missense	probably damaging	1.00
IGL03178:Lig3	APN	11	82789722	splice site	probably benign
R0001:Lig3	UTSW	11	82790591	missense	probably damaging	1.00
R0115:Lig3	UTSW	11	82793935	missense	probably damaging	1.00
R0834:Lig3	UTSW	11	82798287	missense	probably damaging	0.99
R1460:Lig3	UTSW	11	82795798	splice site	probably benign
R1602:Lig3	UTSW	11	82792194	critical splice donor site	probably null
R1969:Lig3	UTSW	11	82795718	missense	probably benign	0.14
R1971:Lig3	UTSW	11	82795718	missense	probably benign	0.14
R1997:Lig3	UTSW	11	82787666	missense	probably benign	0.00
R3817:Lig3	UTSW	11	82796115	missense	possibly damaging	0.75
R4083:Lig3	UTSW	11	82790494	missense	probably benign	0.31
R4084:Lig3	UTSW	11	82795424	missense	probably damaging	1.00
R4665:Lig3	UTSW	11	82800250	missense	probably damaging	0.99
R4737:Lig3	UTSW	11	82787727	missense	probably damaging	1.00
R5212:Lig3	UTSW	11	82787678	missense	probably benign
R5274:Lig3	UTSW	11	82797292	splice site	probably null
R6320:Lig3	UTSW	11	82794007	critical splice donor site	probably null
R6807:Lig3	UTSW	11	82783751	missense	probably benign	0.00
R7552:Lig3	UTSW	11	82788891	missense	probably benign	0.00
R7646:Lig3	UTSW	11	82783478	missense	probably benign	0.00
R7910:Lig3	UTSW	11	82797775	missense	probably damaging	0.99
R7966:Lig3	UTSW	11	82790516	missense	probably damaging	1.00
R8001:Lig3	UTSW	11	82792076	missense	probably benign	0.18
R8436:Lig3	UTSW	11	82792044	missense	possibly damaging	0.82
R8699:Lig3	UTSW	11	82794550	missense	probably damaging	1.00
R9352:Lig3	UTSW	11	82796145	missense	probably benign	0.01
R9392:Lig3	UTSW	11	82789840	missense	probably benign	0.06
R9452:Lig3	UTSW	11	82790622	missense	probably damaging	1.00
R9469:Lig3	UTSW	11	82795373	missense	probably benign	0.01
R9726:Lig3	UTSW	11	82783594	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGGAGCCCAGTAAGTCAAGTG -3'
(R):5'- AGAACAACTTGCCCAGGCTG -3'

Sequencing Primer
(F):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
(R):5'- TGAGGGGCTACCAGGTG -3'

Posted On

2019-05-15