Incidental Mutation 'R7103:Hoxb2'
ID 551004
Institutional Source Beutler Lab
Gene Symbol Hoxb2
Ensembl Gene ENSMUSG00000075588
Gene Name homeobox B2
Synonyms Hox-2.8, Hoxbes2
MMRRC Submission 045195-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.617) question?
Stock # R7103 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 96242458-96244846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96244447 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 353 (F353L)
Ref Sequence ENSEMBL: ENSMUSP00000098092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100523]
AlphaFold P0C1T1
Predicted Effect possibly damaging
Transcript: ENSMUST00000100523
AA Change: F353L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098092
Gene: ENSMUSG00000075588
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 76 94 N/A INTRINSIC
low complexity region 99 118 N/A INTRINSIC
HOX 141 203 2.54e-28 SMART
low complexity region 204 213 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
Meta Mutation Damage Score 0.1989 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with pancreatic cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele die neonatally with altered segmental identity and abnormal migration of motor neurons in the hindbrain. Mice homozygous for null alleles can exhibit partial postnatal lethality, narrow face, runting, absent facial motor nuclei, and facial nerve/muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 A G 11: 50,628,181 (GRCm39) T294A probably damaging Het
Adamtsl2 G A 2: 26,997,473 (GRCm39) V893I probably damaging Het
Amph T A 13: 19,333,908 (GRCm39) D656E probably benign Het
Aoah T C 13: 21,207,485 (GRCm39) F568S probably damaging Het
Atr G A 9: 95,747,425 (GRCm39) G236S probably damaging Het
Brd3 T A 2: 27,340,406 (GRCm39) Q601L probably damaging Het
Ccar2 T C 14: 70,379,426 (GRCm39) E524G probably damaging Het
Cog2 T C 8: 125,267,853 (GRCm39) probably null Het
Csnka2ip C A 16: 64,299,120 (GRCm39) V415F unknown Het
Dmp1 A T 5: 104,359,729 (GRCm39) D135V probably damaging Het
Dtna T C 18: 23,786,436 (GRCm39) probably null Het
Endou A G 15: 97,616,810 (GRCm39) S238P probably damaging Het
Ep400 T A 5: 110,881,651 (GRCm39) E779D unknown Het
Fcgbp A G 7: 27,784,387 (GRCm39) E149G probably benign Het
G6pc1 C A 11: 101,265,413 (GRCm39) probably null Het
Gmeb1 T C 4: 131,962,179 (GRCm39) H160R probably damaging Het
Gramd1b T C 9: 40,312,902 (GRCm39) Y22C unknown Het
Hcrtr2 C T 9: 76,161,793 (GRCm39) G199D probably benign Het
Itpr2 C A 6: 146,226,572 (GRCm39) V1391F probably damaging Het
Jakmip2 T A 18: 43,673,648 (GRCm39) probably null Het
Kcnmb4 T C 10: 116,309,164 (GRCm39) Y88C possibly damaging Het
Kif1a T C 1: 93,005,507 (GRCm39) Y89C probably damaging Het
Kif23 T A 9: 61,827,174 (GRCm39) K892N probably damaging Het
Lama3 T A 18: 12,664,936 (GRCm39) S646T probably benign Het
Lig3 T A 11: 82,688,138 (GRCm39) M709K probably benign Het
Mindy3 C A 2: 12,405,885 (GRCm39) A137S possibly damaging Het
Mis18bp1 T C 12: 65,196,057 (GRCm39) E569G possibly damaging Het
Misp T A 10: 79,662,999 (GRCm39) L472Q probably damaging Het
Mrps5 A T 2: 127,443,330 (GRCm39) T303S probably damaging Het
Msh3 T G 13: 92,411,308 (GRCm39) I630L probably benign Het
Muc21 C A 17: 35,932,432 (GRCm39) A585S unknown Het
Myo16 A G 8: 10,619,673 (GRCm39) Y1408C unknown Het
N4bp2 T C 5: 65,964,189 (GRCm39) V746A probably benign Het
Oga G A 19: 45,771,605 (GRCm39) probably benign Het
Or4c120 A G 2: 89,000,827 (GRCm39) I243T possibly damaging Het
Or4d11 A G 19: 12,013,752 (GRCm39) M118T probably damaging Het
Or5p56 A G 7: 107,589,805 (GRCm39) T78A possibly damaging Het
Ostf1 C T 19: 18,573,715 (GRCm39) M44I probably null Het
Pik3c2b T G 1: 133,033,712 (GRCm39) L1572R probably damaging Het
Pilra T C 5: 137,829,488 (GRCm39) D192G possibly damaging Het
Pkhd1l1 A G 15: 44,437,027 (GRCm39) I3462V probably benign Het
Plekhh1 A G 12: 79,113,429 (GRCm39) D619G probably benign Het
Pramel31 C T 4: 144,090,297 (GRCm39) R446C probably benign Het
Ptprb T A 10: 116,174,718 (GRCm39) Y797N probably damaging Het
Rb1 T C 14: 73,500,084 (GRCm39) D521G probably damaging Het
Rnf17 T G 14: 56,708,763 (GRCm39) F728V possibly damaging Het
Slc16a4 T C 3: 107,218,787 (GRCm39) S463P probably damaging Het
Slc4a1 A T 11: 102,244,693 (GRCm39) I634K probably damaging Het
Slc4a1ap T C 5: 31,701,201 (GRCm39) V634A probably benign Het
Spam1 A G 6: 24,800,583 (GRCm39) M441V probably benign Het
Teddm3 A C 16: 20,971,729 (GRCm39) L280* probably null Het
Tmem231 T C 8: 112,645,517 (GRCm39) probably null Het
Tom1l1 T C 11: 90,561,907 (GRCm39) probably null Het
Topors C T 4: 40,261,706 (GRCm39) G526D probably benign Het
Trpm6 A T 19: 18,790,911 (GRCm39) I649F possibly damaging Het
Ttc16 T A 2: 32,664,440 (GRCm39) M66L probably benign Het
Tubgcp6 A G 15: 88,985,232 (GRCm39) F1619L probably damaging Het
Vps13d G T 4: 144,842,062 (GRCm39) A2619E Het
Vps8 G A 16: 21,345,191 (GRCm39) R838H probably damaging Het
Vwde T A 6: 13,215,799 (GRCm39) M86L probably benign Het
Zfp64 A T 2: 168,768,357 (GRCm39) D418E probably benign Het
Zfp952 C T 17: 33,222,606 (GRCm39) P362S possibly damaging Het
Zglp1 T C 9: 20,977,368 (GRCm39) E149G probably benign Het
Other mutations in Hoxb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Hoxb2 APN 11 96,243,910 (GRCm39) missense probably damaging 1.00
R3951:Hoxb2 UTSW 11 96,244,001 (GRCm39) missense probably damaging 0.98
R6950:Hoxb2 UTSW 11 96,242,727 (GRCm39) missense probably benign 0.34
R7673:Hoxb2 UTSW 11 96,244,283 (GRCm39) missense possibly damaging 0.83
R8784:Hoxb2 UTSW 11 96,242,736 (GRCm39) missense possibly damaging 0.62
R9166:Hoxb2 UTSW 11 96,244,339 (GRCm39) missense probably damaging 0.98
R9583:Hoxb2 UTSW 11 96,242,725 (GRCm39) missense probably damaging 0.97
Z1177:Hoxb2 UTSW 11 96,242,815 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATTCGCCTTTTCTACCGG -3'
(R):5'- TTGTAAGAAAACCCTCTCCCACTAGAG -3'

Sequencing Primer
(F):5'- GGACCTCAATTTCTTCGCTGCAG -3'
(R):5'- CGTTGGAAGGAGTTTTACCAAG -3'
Posted On 2019-05-15